MB ASCP CONNECT EXAM
QUESTIONS AND ANSWERS 100%
PASS
What is translocation is associated with Burkitt's Lymphoma?
a. t(18; 14)
b. t(9; 22)
c. t(8; 14)
d. t(15; 17)—ANSWER-t(8; 14)
TIP: Burkkitt's 8 letters,
Locus PF Child Paternity Index
LOC-A1 3 2/3 2.18
LOC-B2 7/5 5 0.798
LOC-C3 17/17 9/17 5.21
,LOC-D4 12 12 1.37
Based on the data presented in the table above and with a prior probability (PP) of 0.5, the
probability of paternity in this case is :
a. 92.5%
b. 99.5%
c. 90.5 &
d. 95.5%—ANSWER-92.5 %
Multiply all PI together = CPI
(CPI x PP) / [CPI x P + (1 - PP)
OR ...
CPI / (1 + CPI)
You have sequenced a gene and observe the following:
Reference: atgctggcacgacaggtttcccgactgg
© 2026 Copyright. All Rights Reserved. This document is
protected by copyright law, Copyrighted By Brittie Donald
,Sequenced: atgCctggcacgacaggtttcccgactgg
The mutation observed is a:
a. Frame-shift mutation
b. Insertion
c. Silent mutation
d. Non-conservative mutation—ANSWER-Frame-shift mutation
Which of the following is not involved in the splicing reaction?
a. 5' splice site
b. Hairpin loops
c. Branch A point
d. 3' splice site—ANSWER-Hairpin loops
Which of the following statements are characteristics of the melt curve analysis? (hint: more
than one answer)
a. At the melting point, the probe separates from the target strand and fluorescence rapidly
decreases.
, b. The melting temperature of double stranded DNA depends on its base composition and
length.
c. All PCR products for a specific primer pair should have the same melting temperature.
d. When hybridization probes are utilized, the temperature is incrementally decreased while
fluorescence is monitored.—ANSWER-At the melting point, the probe separates from the
target strand and fluorescence rapidly decreases.
The melting temperature of double stranded DNA depends on its base composition and
length.
All PCR products for a specific primer pair should have the same melting temperature.
In the field of molecular diagnostics, which one of the following genes is responsible for the
synthesis of DNA, promote cell division, and inhibit cell death?
a. Proto-oncogenes
b. Tumor suppressor genes
c. Oncogenes
d. Mitochondrial genes—ANSWER-Proto-oncogenes
Microsatellite instability is best described as:
© 2026 Copyright. All Rights Reserved. This document is
protected by copyright law, Copyrighted By Brittie Donald
QUESTIONS AND ANSWERS 100%
PASS
What is translocation is associated with Burkitt's Lymphoma?
a. t(18; 14)
b. t(9; 22)
c. t(8; 14)
d. t(15; 17)—ANSWER-t(8; 14)
TIP: Burkkitt's 8 letters,
Locus PF Child Paternity Index
LOC-A1 3 2/3 2.18
LOC-B2 7/5 5 0.798
LOC-C3 17/17 9/17 5.21
,LOC-D4 12 12 1.37
Based on the data presented in the table above and with a prior probability (PP) of 0.5, the
probability of paternity in this case is :
a. 92.5%
b. 99.5%
c. 90.5 &
d. 95.5%—ANSWER-92.5 %
Multiply all PI together = CPI
(CPI x PP) / [CPI x P + (1 - PP)
OR ...
CPI / (1 + CPI)
You have sequenced a gene and observe the following:
Reference: atgctggcacgacaggtttcccgactgg
© 2026 Copyright. All Rights Reserved. This document is
protected by copyright law, Copyrighted By Brittie Donald
,Sequenced: atgCctggcacgacaggtttcccgactgg
The mutation observed is a:
a. Frame-shift mutation
b. Insertion
c. Silent mutation
d. Non-conservative mutation—ANSWER-Frame-shift mutation
Which of the following is not involved in the splicing reaction?
a. 5' splice site
b. Hairpin loops
c. Branch A point
d. 3' splice site—ANSWER-Hairpin loops
Which of the following statements are characteristics of the melt curve analysis? (hint: more
than one answer)
a. At the melting point, the probe separates from the target strand and fluorescence rapidly
decreases.
, b. The melting temperature of double stranded DNA depends on its base composition and
length.
c. All PCR products for a specific primer pair should have the same melting temperature.
d. When hybridization probes are utilized, the temperature is incrementally decreased while
fluorescence is monitored.—ANSWER-At the melting point, the probe separates from the
target strand and fluorescence rapidly decreases.
The melting temperature of double stranded DNA depends on its base composition and
length.
All PCR products for a specific primer pair should have the same melting temperature.
In the field of molecular diagnostics, which one of the following genes is responsible for the
synthesis of DNA, promote cell division, and inhibit cell death?
a. Proto-oncogenes
b. Tumor suppressor genes
c. Oncogenes
d. Mitochondrial genes—ANSWER-Proto-oncogenes
Microsatellite instability is best described as:
© 2026 Copyright. All Rights Reserved. This document is
protected by copyright law, Copyrighted By Brittie Donald
