MB (ASCP) Exam Questions and
Answers 100% PASS
After an amplification procedure followed by gel electrophoresis, you took a photo of your
gel. You notice consistent bands in all your gel lanes. However, you also see what appears to
be a faint but noticeable band in your reagent blank lane. What is your best explanation for
the reagent blank band?—ANSWER-There was obvious contamination in this PCR reaction
Nucleic acid hybridization methods can be affected by a host of factors. Select all the factors
that can influence this process.—ANSWER-G:C ration bases
pH of the hybridization reaction
Hybridization temperature
Which of the subunits of RNA polymerase holoenzyme is responsible for promoter
recognition?—ANSWER-Sigma subunit
Characteristics of eukaryotic DNA transcription?—ANSWER-Multiple RNA polymerases
TATA-binding protein
Transcription factors
What stain binds to minor groove of DNA Duplex?—ANSWER-SYBR1
,There are many types of RNA molecules, each of which has a specific function within the
cell. Which type of RNA molecule is responsible for transporting amino acids during protein
synthesis?—ANSWER-Transfer RNA (tRNA)
When this enzyme finds nicks or gaps in the sugar-phosphate backbone of DNA, it closes
them—ANSWER-Ligase
In CML, what fusion protein is created?—ANSWER-BCR-ABL1
PCR Steps—ANSWER-1. Denaturation
2. Annealing
3. Extension
Its discovery shed light on why there is simultaneous, though not continuous, synthesis of
DNA on both leading and lagging strands of DNA:—ANSWER-Okazaki fragments
What is the sequence recognized by poly (A) polymerase?—ANSWER-AAUAAA
What volume of DNA (in microliters) is required to prepare a restriction digest that requires
10 µgs of DNA when the stock DNA is 5 µg/µl?
0.5 µl
1 µl
2 µl
5 µl—ANSWER-2 µl
Next Generation Sequencing set-up require:—ANSWER-Library preparation and extensive
bioinformatics analysis
© 2026 Copyright. All Rights Reserved. This document is
protected by copyright law, Copyrighted By Brittie Donald
, What does barcoding do in Next Generation Sequencing?—ANSWER-Adds a unique tag to all
nucleic acids within one sample so that various samples can be mixed
Bone marrow transplantation is a great method used to treat several malignant and benign
cancers, particularly leukemias. Before transplantation (or engraftment analysis), several
polymorphic loci are screened in both the recipient and donor cells. The mail goal of this
screening is to:—ANSWER-find at least one or more informative loci between both the
donor and recipient
All of the following methods of amplification are considered target amplification, except:
Quantitative PCR
NASBA
Strand Displacement Amplification
Reverse Transcriptase PCR—ANSWER-NASBA
Consider the table below where a child and a possible father (PF) share the listed paternity
indices for each locus listed (LOC-A1, LOC-B2, LOC-C3, LOC-D4). Based on the data presented
in the table, what is the combined paternity index, CPI, from the loci tested: LOC-A1, LOC-B2,
LOC-C3 and LOC-D4?—ANSWER-12.42
Consider the probe sequence, CTACCGTAATATTCGACCGT, to be used in a hybridization
procedure. What is the melting temperature, Tm, of the sequence?—ANSWER-58°C
What assay amplifies the target using DNA polymerase?—ANSWER-PCR
Bone marrow transplantation is used to treat several malignant and benign cancers,
particularly leukemias. Donor matching to assess immune system compatibility is a central
Answers 100% PASS
After an amplification procedure followed by gel electrophoresis, you took a photo of your
gel. You notice consistent bands in all your gel lanes. However, you also see what appears to
be a faint but noticeable band in your reagent blank lane. What is your best explanation for
the reagent blank band?—ANSWER-There was obvious contamination in this PCR reaction
Nucleic acid hybridization methods can be affected by a host of factors. Select all the factors
that can influence this process.—ANSWER-G:C ration bases
pH of the hybridization reaction
Hybridization temperature
Which of the subunits of RNA polymerase holoenzyme is responsible for promoter
recognition?—ANSWER-Sigma subunit
Characteristics of eukaryotic DNA transcription?—ANSWER-Multiple RNA polymerases
TATA-binding protein
Transcription factors
What stain binds to minor groove of DNA Duplex?—ANSWER-SYBR1
,There are many types of RNA molecules, each of which has a specific function within the
cell. Which type of RNA molecule is responsible for transporting amino acids during protein
synthesis?—ANSWER-Transfer RNA (tRNA)
When this enzyme finds nicks or gaps in the sugar-phosphate backbone of DNA, it closes
them—ANSWER-Ligase
In CML, what fusion protein is created?—ANSWER-BCR-ABL1
PCR Steps—ANSWER-1. Denaturation
2. Annealing
3. Extension
Its discovery shed light on why there is simultaneous, though not continuous, synthesis of
DNA on both leading and lagging strands of DNA:—ANSWER-Okazaki fragments
What is the sequence recognized by poly (A) polymerase?—ANSWER-AAUAAA
What volume of DNA (in microliters) is required to prepare a restriction digest that requires
10 µgs of DNA when the stock DNA is 5 µg/µl?
0.5 µl
1 µl
2 µl
5 µl—ANSWER-2 µl
Next Generation Sequencing set-up require:—ANSWER-Library preparation and extensive
bioinformatics analysis
© 2026 Copyright. All Rights Reserved. This document is
protected by copyright law, Copyrighted By Brittie Donald
, What does barcoding do in Next Generation Sequencing?—ANSWER-Adds a unique tag to all
nucleic acids within one sample so that various samples can be mixed
Bone marrow transplantation is a great method used to treat several malignant and benign
cancers, particularly leukemias. Before transplantation (or engraftment analysis), several
polymorphic loci are screened in both the recipient and donor cells. The mail goal of this
screening is to:—ANSWER-find at least one or more informative loci between both the
donor and recipient
All of the following methods of amplification are considered target amplification, except:
Quantitative PCR
NASBA
Strand Displacement Amplification
Reverse Transcriptase PCR—ANSWER-NASBA
Consider the table below where a child and a possible father (PF) share the listed paternity
indices for each locus listed (LOC-A1, LOC-B2, LOC-C3, LOC-D4). Based on the data presented
in the table, what is the combined paternity index, CPI, from the loci tested: LOC-A1, LOC-B2,
LOC-C3 and LOC-D4?—ANSWER-12.42
Consider the probe sequence, CTACCGTAATATTCGACCGT, to be used in a hybridization
procedure. What is the melting temperature, Tm, of the sequence?—ANSWER-58°C
What assay amplifies the target using DNA polymerase?—ANSWER-PCR
Bone marrow transplantation is used to treat several malignant and benign cancers,
particularly leukemias. Donor matching to assess immune system compatibility is a central
