CHEM210 / CHEM 210 Module 6: (Latest Update 2026 / 2027) Organic Chemistry | Questions & Answers | Grade A | 100% Correct – Portage Learning

CHEM210 / CHEM 210 Module 6: (Latest Update 2026 / 2027) Organic Chemistry | Questions & Answers | Grade A | 100% Correct – Portage Learning Q: What is the difference between a nucleoside and nucleotide? Answer A nucleoside is formed from the covalent bonding of a base (purine or pyrimidine) to either ribose (RNA) or 2-deoxyribose (DNA). Nucleotides are built from a nitrogen containing organic base, a monosaccharide, and phosphate. Q: What characteristic makes purines and pyrimidine heterocyclic? Answer Each has a ring with nitrogen in the ring instead of all carbon atoms in the ring. Q: Is this molecule ribose or 2-deoxyribose? Briefly explain what structural information was used to determine this. Answer Ribose. This molecule contains an -OH on carbon 2. 2-deoxyribose has an -H atom on the second carbon. Q: Is the following a pyrimidine or purine? Provide the name and one-letter symbol. Answer Pyrimidine. It is thymine (T). Q: What is the difference between thymine and uracil? Answer These two bases differ by a methyl group. Thymine has an extra methyl group on the ring. Q: From the course and module information, where in a eukaryotic or prokaryotic cell, is the DNA located? How about the RNA? Answer DNA is located in the nucleus of a eukaryotic cell or the nucleoid of a prokaryotic cell. RNA is found in the nucleus, on the ribosome, and in other parts of the cell. Q: Which DNA and RNA bases contain a carbonyl group? Answer Guanine, cytosine, thymine, and uracil all contain C=O group attached to the rings. Adenine is the only base that does not. Q: What constitutes the backbone of DNA? Answer In DNA, this consists of the alternating deoxyribose and phosphate groups linked together through covalent bonds. Q: How many hydrogen bonds form between A and T? Answer Two hydrogen bonds are formed between these two bases. G and C form three H-bonds. Q: Which nucleic acid is single-stranded? Answer RNA. RNA forms single strands. (Particularly, this was noted in this module for tRNA.) DNA forms a double helix. Q: What interactions stabilize the DNA double helix? Answer Hydrogen bonds stabilize the helix. Each AT pair and form two hydrogen bonds, and each GC pair forms three hydrogens that stabilize the helix, permitting it to maintain this shape. Q: What type of RNA has a sequence that is complementary to DNA? Answer mRNA is complementary so that it can transmit the information to the ribosome. Q: Which has the largest molecular weight chains: mRNA, tRNA, or rRNA? Answer rRNA. These molecules make up ribosomes. Q: What structural forms of DNA have a right-handed helix? Which form has a left handed helix? Answer The A- and B-forms are right-handed, while the Z-form is left-handed. Q: What function does cAMP perform in cells? Answer cAMP is a communication molecule in cellular signaling. It acts as a secondary messenger. Q: In DNA, adenine always pairs with ________. - Thymine - Guanine - Uracil - Cytosine Answer - Thymine Q: DNA is built from which of the following? - Nucleosides - Genes - Purines - Nucleotide - Codons Answer - Nucleotide Q: The double helix of DNA is stabilized mainly by __________. - Ionic bonds - Covalent bonds - Ion-dipole bonds - Hydrogen bonds - Hydrogen covalent bonds Answer - Hydrogen bonds Q: Which of the following pentose sugars is a constituent of DNA? - Xylose - Ribitol - 2-deoxyribose - Arabinose - Ribose Answer - 2-deoxyribose Q: Pyrimidines have ________ ring(s), (each) containing ______ nitrogen(s), whereas purines have ________ ring(s), (each) containing ______ nitrogen(s). - 1; 1; 1; 1 - 1; 2; 2; 2 - 2; 2; 1; 2 - 2; 1; 1; 2 - 2; 2; 1; 1 Answer - 1; 2; 2; 2 Q: Identify the base guanine from among the following structures. Answer 5 NH in rings with a double bonded O Q: Which of the following nucleic acids is responsible for using the encoded genetic information to produce of proteins found in living organisms? - Peptide nucleic acid - Ribonucleic acid - Ribitol nucleic acid - Deoxyribonucleic acid - Glycerol nucleic acid Answer - Ribonucleic acid Q: Identify the complementary bases from the following. - Adenine-Cytosine - Adenine- Thymine - Guanine-Thymine - Guanine-Adenine - Cytosine-Uracil Answer - Adenine- Thymine How many hydrogen bonds are made between G and its complementary nucleotide? - 1 - 2 - 3 - 4 - 5 Answer - 3 The base sequence along one strand of DNA of 5'-GCATGAGCC-3'. What is the sequence of the complementary strand of DNA? - 5'-CTAGTCCGC-3' - 3'-CGTACTCGG-5' - 3'-CTAGTCCGC-5' - 3'-CAGTCAGCT-5' - 5'-CTGACTACG-3' Answer - 3'-CGTACTCGG-5' Which of the following types of RNA functions to carry genetic information from the DNA to ribosome? - mRNA - gRNA - rRNA - snRNA - tRNA Answer - mRNA Which of the following is the set of three sequential nucleotides that encodes for a particular amino acid? - Codon - Anticodon - Allele - Gene - Chromosome Answer - Codon A type of DNA that has a right-handed helix is the __________. - t-form - X-Form - B-form - L-form - Z-form Answer - B-form Which of the following is a second messenger in cells? - FAD - cAMP - AMP - dATP - UTP Answer - cAMP Which of the following acts a coenzyme? - FAD - ATP - AMP - cAMP - GGG Answer - FAD rRNA makes up about _________ percent of ribosomes. - Answer - 65 The conclusion that G and C are present in DNA in equimolar is credited to ______. - James Watson - Francis Crick - Erwin Chargaff - Both A and B - None of the above - Erwin Chargaff The order of nucleotides in DNA is written __________. to C C to N - 3' to 5' - 5' to 3' - Both C and D - 5' to 3' In the Watson-Crick model for the double helix, which statement is NOT true? - The two strands run anti-parallel to one another - The base-pairing occurs on the inside of the double helix. - The double helix (B form) is right-handed. - Two equally sized grooves that run up the sides of the helix. - The two strands have complementary sequences. - Two equally sized grooves that run up the sides of the helix. In the tRNA, below, the amino acid is attached to which position? A Besides ATP, which other nucleotide is part of energy storage in cells? - ATP - UTP - TTP - CTP - GTP - GTP heterocyclic ring shaped carbon chain which has to have at least one atom that isn't carbon in the ring A major component of RNA but not DNA is: - AMP - GMP - UMP - CMP - TMP - UMP Scientists say that two DNA strands are complementary. Briefly describe what is meant by complementary Show one example in your response. The nucleotide sequences of complementary strands are such that, whenever an A occurs in one strand, there is a T in the other strand with which it can form a hydrogen bonded base pair. Whenever a C occurs in one strand, a G occurs in the other. A is the base that is complementary to T, and C is the base complementary to G. Briefly describe how noncovalent interactions contribute to the three-dimensional shapes and structures of RNA molecules. Hydrogen bonding in regions of complementarity within an RNA chain can result in the formation of a structure. If no complementary regions exist then an unstructured area will exist within the RNA. In one sentence, identify the most noticeable difference between the A-form of DNA and the Z form of DNA. The Z-form of DNA is left handed while the A-form of DNA is right handed. In nucleic acid chemistry, compounds that contain an organic nitrogen-containing base, a sugar, and phosphate group are called ____A_____. Two purines found in DNA in are _____B____ and ____B____. A pyrimidine found in all RNA but not in DNA is ____C_____. In DNA, the pair ____D_____ is held together by three hydrogen bonds. In DNA, the pentose _____E_______ serves as the monosaccharides. A) nucleotides B) adenine and guanine C) uracil D) C - G E) 2-deoxyribose The monomers of RNA nucleic acids, called nucleotides, consist of three parts. What are those three parts? A base, monosaccharide, and phosphoric acid Most common nucleic acids Deoxyribonucleic acid (DNA) Ribonucleic acid (RNA) Nucleic acid monomers nucleotides DNA function stores genetic info encoding primary sequence of proteins RNA function makes proteins from info in DNA Nucleotide structure base + monosaccharide + phosphoric acid (H3PO4) Site of phosphoric acid bonding to sugar Carbon 5 Composition of bases heterocyclic organic compounds containing N Purine structure 2 rings fused together Purine bases Adenine and Guanine Pyramidine structure single ring Pyramidine bases Cytosine, thymine (DNA), uracil (RNA) Distinction between thymine and uracil Thymine has an extra methyl group (looks like an antenna) RNA sugar D-ribose; carbon 2 has an -OH group DNA sugar 2-deoxy-D-ribose; Carbon 2 has -H Nucleoside structure base covalently bonded to ribose or 2-deoxyribose Site of base + sugar bonding anomeric carbon of sugar and N of base primary structure of nucleic acids covalent bonding of phosphate groups and sugar to form backbone 5' end phosphate group is located at carbon 5 of sugar 3' end hydroxyl group (-OH) is located at carbon 3 of sugar What dictates primary structure of DNA? Order of bases from 5' to 3' Oligonucleotide A chain of 50 or fewer nucleotides DNA secondary structure Any stable structure taken up by some or all of the nucleotides, such as a double helix DNA tertiary structure massive, more complex folding structures Discovery of DNA double helix structure 1953, Watson & Crick Erwin Chargaff Conclusions 1. Base composition of DNA varies between species 2. DNA isolated from different tissues or parts of an organism is the same 3. In DNA, A&T are equimolar; C&G are equimolar Structure of DNA double helix 2 complementary (anti-parallel) polynucleotide chains held in place by Hydrogen bonds Number of Hydrogen bonds between A and T 2 Number of hydrogen bonds between G and C 3 A, B, Z forms of DNA Variants differing by bases per turn and distance of helix rise per turn Most common form of DNA B form Z form DNA distinctions left handed helix, left handed twist, can exist when C bases become methylated Gene Chromosomal segment of DNA containing sequence to produce one protein molecule Codon A sequence of three adjacent nucleotides that encode for a specific amino acid Typical number of nucleotides to encode for a full protein 150-2000 mRNA structure single strand, complementary to DNA, contains U instead of T mRNA function carries sequence of nucleotides needed to code a protein to ribosomes tRNA function Transports specific amino acids to ribosomes; pairs with mRNA to add the amino acid to a growing polypeptide chain Typical number of nucleotides in tRNA chain 70-90 Amino acid attachment to tRNA Covalent bond anticodon sequence of 3 nucleotides on tRNA complementary to a codon for an amino acid on mRNA Production method of secondary structure in tRNA Can fold on itself by H bonding of complementary base pairs rRNA Ribosomal RNA; RNA complexed with a set of proteins to form ribosomes Ribosome composition 35% protein, 65% rRNA Size of rRNA 1 million Daltons Structure of rRNA similar to globular proteins. rRNA forms helices, proteins form a-helices, turns, and b sheets What happens when ATP is used for energy? It breaks down to AMP or ADP with production of an inorganic phosphate; ADP and AMP can reform into ATP GTP function Formed in citric acid cycle to store energy. Can transfer a phosphate group to ADP to form ATP cAMP function Second messenger, after primary signal of adrenaline, it stimulates liver cells to export glucose actively AMP function part of energy production Feature of cAMP structure structure allows it to bind to a protein Nucleotide coenzyme functions 1. Aid in binding a substrate 2. Carrier molecule 3. Activates molecules 4. Takes part in oxidation/reduction reactions FAD (flavin adenine dinucleotide) composition ADP, ribitol sugar, flavin FAD function Shuttles H atoms from one molecule to another in enzyme catalyzed reactions How would you identify a compound as an Acid? Acids contain/begin with H and end with a polyatomic group/non metal How would you identify a compound as a Base? Bases usually begin with a metal and ends with OH polyatomic group How would you identify a compound as a Salt? Salts contain a Metal and a Nonmetal/Polyatomic group What are the properties of acids?(6) 1. Sour Taste 2. Litmus dye from purple to red 3. pH 7 4. Reacts with metals to produce H2 gas. 5. Neutralizes bases to produce water and salt. 6. Dissolves in water to produce a solution that conducts electricity. What are the properties of bases?(6) 1. Bitter taste 2. Litmus dye from purple to blue 3. pH 7 4. Reacts with acids to make water and salt. 5. Slippery when wet. 6. Creates electricity. What are the properties of salts?(4) 1. Hard and brittle 2. pH~7 3. Dissolves in water 4. Produced by the neutralization of acids and bases. How would you be able to identify a Lewis acid or a Lewis base: Lewis bases are electron pair donors. Lewis acids are electron pair acceptors. How would you determine Strong acids/bases and Weak acids/bases? Proton acceptors are Bases. Proton donators are Acids. The bigger arrow lets you know which one is bigger. (points towards weaker) How do find conjugate acids and bases: Acids will have one more H+ ion. Bases will have one less H+ ion. Make sure you do the math for the charges. The normal ion charge is 0 unless otherwise seen. How do you find the Stronger acid out of two? (In oxygen based pairs) The one with a more Oxygen has more O-H bonds making it stronger. How do you find the stronger Acid in general? The bigger the size of a molecule, the weaker it is. Size increases down groups and increases across periods. Weak bonds=Strong acids. How would you complete a neutralization reaction? You take an acid and a base and you would create water and salt. Bases are cations. Acids are anions. How would you complete a metal and acid reaction? They come together to form H2 (g) How would you complete a metal oxide and acid reaction? They will act just like neutralization. You will see the oxygen in the reactants side. How would you complete salt and acid reaction? This will make a double reaction and then it will make H2O and CO2/SO2 or H2S gas. This is what causes the acid-rain erosion on statues and grave stones. How would you complete a nonmetal oxide and base reaction? It will make water and salt (that has the metal cation and non metal) How would you answer this kind of equation: Show the calculation of the pH of a 0.00275 M solution of the strong acid H2SO4. You would take the Mole amount and then see how much of the acid or base is in the equation. Multiply the moles by that amount. Then you plug it into the pH=-log. If it was an acid, you're done. If it was a base you must minus it from 14. In this example it is: 0.00275 x 2 (Because there is 2 hydrogens) then you put in the calculator -log(.0055) You get 2.260 How would you answer this equation: Show the calculation of the [OH-] of a solution whose pH = 10.34. (2 ways) You would first subtract this pH from 14 if it is a base. (no need if its an acid) Then you would find the anti log of the negative pH. Anti log is just 10^-pH. 14-10.34=3.66 antilog(-3.66)= 2.2x10^-4 The other way for base is to find the anti log directly, equal that to 1x10^-14. You could find it like that. How would you find out if a solution is basic or acid from having just the moles? Kw=H+OH- which equals 1x10^-14 Solve for the solution moles you don't have. If OH- 1x10-7 it's basic. If H+ 1x10^-7 its acidic. How would you solve an acid base titration problem: In the titration of 0.127 grams of Al(OH)3 in the presence of bromothymol blue indicator, the blue solution turns yellow after 22.3 mL of H2SO4 of unknown concentration is added. Show the calculation of the molarity of the H2SO4 solution? First you check what is given to you in the equation: Grams or M. Then you take the appropriate formula and insert everything. With the S part of the formula: this is how many of the acid or base there is in the formula. So for example Al(OH3) means there is three bases and H2 means there is 2. This is important. (H2SO4 is the acid and Al(OH)3 is the base) Ma x mLa / 1000 x Sa / Sb = gb / MWb Ma x 22.3 / 1000 x 2 / 3 = 0.127 / 78.004 MH2SO4 = 0.110 M How would you solve weak acid/base problem like this: Determine the value of Ka for propionic acid (HC3H5O2), if the pH of a 0.115 M solution is 2.913. First you find the antilog of the pH (antilog is 10^-x) Then you plug in the Ka or Kb formula. Where the full acid will be equal to just the M in the problem. HC3H5O2 - H+ + C3H5O2 pH=2.913 [H+] = antilog (-pH) antilog (- 2.913) = 1.22 x 10-3 Ka = [H+][A-]/[HA] Ka=[H+][C3H5O2]/[HC3H5O2] Ka=(1.22 x 10-3) (1.22 x 10-3)/(.115) Ka=1.29x10-5 How would you solve a weak acid/base problem like this: Show the calculation of the [OH-], pH and % ionization for 0.118 M ammonia (NH3), if Kb = 1.8 x 10-5. First You set out the problem so you react it with H2O in order to get your base. Then you find out what each one will equal to. Usually it is the compound-x and the others are just x. Set it equal to the Kb in the formula using Kb from the formula chart. This answer is your OH. Then you find the -log of this number. Because it is a base you minus the answer by 14 to get it. Then you take % ionization formula, put the answer over the original M in the formula. Multiply it by 100. NH3 + H2O - NH4+ + OH- .118 ignore 0 0 -x +x +x .118-x x x Kb = [OH-][B+]/[BOH] 1.8 x10-5 = (x)(x)/.118-x The -x can be ignored. 1.8 x10-5=x2/.118 (.118)x1.8 x10-5=x2 x=1.46x10-3 [OH-]=1.46x10-3 p[OH-]=-log[OH-]= -log[1.46x10-3]=2.84 pH=14-2.84=11.16 %ionization: 1.46x10-3/.118 x100= 1.24% What are cations of strong bases? Na+, K+, Li+, Mg+2, Ca+2 What are anions of strong acids? Cl-, Br-, NO3-, SO4-2, HSO4-, H2PO4-2 strong base + strong acid = weak base + strong acid = strong base + weak acid = Neither hydrolyze (neutral) Acidic since the base hydrolyzes to form a weak base and H3O+ Basic since the acid hydrolyzes to form a weak acid and OH- How would you solve this: Calculate the pH of a 0.110 M solution of the salt, NH4Cl. Kb for NH4OH is 1.8 x 10-5. You would take the Kh formula and plug in the Kb or Ka given to you. Using that answer you would equal it to the Kh again, ignoring the H2O Normally it will look like (x)(x)/M-x You can get rid of the -x so it is kh=x2/M You plug this answer into get the -log(kh) and that will be your pH. What is Kw? 1x 10^-14 How do you solve buffer problems? (1) What is the pH of 1.00 L of a buffer containing 0.110 M NH4Cl and 0.110 M NH3? (2) What will the pH be upon addition of 0.0200 mole HCl to 1.00 L of the buffer? (3) What will the pH be upon addition of 0.0200 mole NaOH to 1.00 L of the buffer? So you write it out as usual like: The mol -x ignoring H2O and the other one +x and the last as x. You equal it to Kb The +x and -x cancel out leaving xM/M. This answer is put into -log and that is your pH. The mols are in the problem. For the other two you minus for the first reactant by the new mole amount, while adding it to the product made. (When it is an acid added) You add the reactant, then minus at the product when the base is added. How would you figure out what type of acid and base are involved in a titration curve, and then find the appropriate indicator? You find the equivalence point. This is the pH. It will either be ph=7 making it a strong acid and base. ph7 making it a weak acid and strong base. Or ph7 making it strong acid and weak base. Next find where it rapidly drops. This will indicate which indicator to use. It it okay if you don't have the lowest number in the indicator but you need the highest. How would you solve: Using the titration curve below for an unknown weak acid which has a half-equivalence point at pH = 7.20, calculate the Ka of the weak acid and select it from the list below. Find the antilog of (-x) antilog=10^-x. This will tell you which acid to select from the list. What is the difference between a nucleoside and nucleotide? A nucleoside is formed from the covalent bonding of a base, purine or pyrimidine, to either ribose or 2-deoxyribose. Nucleotides are built from a nitrogen-containing organic base, a monosaccharide, and phosphate. What characteristic makes purines and pyrimidine heterocyclic? Each has a ring with nitrogen in the ring instead of all carbon atoms in the ring. Is this molecule ribose or 2-deoxyribose? Briefly explain what structural information was used to determine this. Ribose. This molecule contains an -OH on carbon 2. 2-deoxyribose has an -H atom on the second carbon. Is the following a pyrimidine or purine? Provide the name and one-letter symbol. Pyrimidine. It is thymine (T). What is the difference between thymine and uracil? These two bases differ by a methyl group. Thymine has an extra methyl group on the ring. From the course and module information, where in a eukaryotic or prokaryotic cell, is the DNA located? How about the RNA? DNA is located in the nucleus of a eukaryotic cell or the nucleoid of a prokaryotic cell. RNA is found in the nucleus, on the ribosome, and in other parts of the cell. Which DNA and RNA bases contain a carbonyl group? Guanine, cytosine, thymine, and uracil all contain C=O group attached to the rings. Adenine is the only base that does not. What constitutes the backbone of DNA? In DNA, this consists of the alternating deoxyribose and phosphate groups linked together through covalent bonds (Figure 6.6). How many hydrogen bonds form between A and T? Two hydrogen bonds are formed between these two bases. G and C form three H-bonds. Which nucleic acid is single-stranded? RNA. RNA forms single strands. Particularly this was noted in this module for tRNA. DNA forms a double helix. What interactions stabilize the DNA double helix? Hydrogen bonds stabilize the helix. Each AT pair and form two hydrogen bonds, and each GC pair forms three hydrogens that stabilize the helix, permitting it to maintain this shape. What type of RNA has a sequence that is complementary to DNA? mRNA is complementary so that it can transmit the information to the ribosome. Which has the largest molecular weight chains: mRNA, tRNA, or rRNA? rRNA. These molecules make up ribosomes. What structural forms of DNA have a right-handed helix? Which form has a left-handed helix? The A- and B-forms are right-handed, while the Z-form is left-handed. What function does cAMP perform in cells? cAMP is a communication molecule in cellular signaling. It acts as a secondary messenger. In DNA, guanine always pairs with ________. Thymine Guanine Uracil Cytosine Both A and B Cytosine The repeating units, or monomers, that are linked together to form nucleic acids are known as _________. Nucleosides Nucleotide Genes Purines Codons Nucleotide The Z-form helix of DNA is stabilized mainly by __________. Ionic bonds Covalent bonds Hydrogen bonds Ion-dipole bonds Hydrogen covalent bonds Hydrogen bonds Which of the following pentose sugars is a constituent of DNA? Xylose Ribitol 2-deoxyribose Arabinose Ribose 2-deoxyribose Purines have ________ ring(s), (each) containing ______ nitrogen(s), whereas pyrimidines have ________ ring(s), (each) containing ______ nitrogen(s). 1; 1; 1; 1 1; 2; 1; 2 2; 1; 1; 2 2; 2; 1; 1 2; 2; 1; 2 2; 2; 1; 2 Identify the base uracil from among the following structures. B _______ enables the production of proteins from genetic information. Codons Ribose nucleic acid Deoxyribonucleic acid Ribonucleic acid Glycerol nucleic acid Ribonucleic acid Identify the complementary bases from the following. Adenine-Cytosine Adenine- Thymine Guanine-Thymine Guanine-Adenine Cytosine-Uracil Adenine- Thymine How many hydrogen bonds are made between T and its complementary nucleotide? 2 3 4 5 6 2 The base sequence along one strand of DNA of 5'-GCATGAGCC-3'. What is the sequence of the complementary strand of DNA? 5'-CTAGTCCGC-3' 3'-CGTACTCGG-5' 3'-CTAGTCCGC-5' 3'-CAGTCAGCT-5' 5'-CTGACTACG-3' 3'-CGTACTCGG-5' Which of the following types of RNA functions as the molecule to bring amino acids to ribosomes? mRNA gRNA rRNA snRNA tRNA tRNA The ________ is the set of three sequential nucleotides that encodes for a particular amino acid. Anticodon Allele Gene Codon Chromosome Codon The type of DNA that has a left-handed helix is the __________. A form B Form C form L form Z form Z form Which of the following is a second messenger in cells? FAD cAMP AMP dATP UTP cAMP Which of the following acts as a coenzyme? FAD ATP AMP cAMP GGG FAD rRNA makes up about _________ percent of ribosomes. 65 35 20 90 0 65 The conclusion that G and C are present in DNA in equimolar amounts is credited to ______. James Watson Francis Crick Erwin Chargaff Both A and B None of the above Erwin Chargaff he primary sequence of DNA is written __________. N to C C to N 5' to 3' 3' to 5' Both A and D 5' to 3' In the Watson-Crick model for the double helix, which statement is NOT true? The two strands run anti-parallel to one another The base-pairing occurs on the inside of the double helix. The double helix (B form) is right-handed. Two equally sized grooves that run up the sides of the helix. The two strands have complementary sequences. Two equally sized grooves that run up the sides of the helix. In the tRNA, below, the amino acid is attached to which position? A (top, open end) Besides ATP, which other nucleotide is part of energy storage in cells? ATP UTP TTP CTP GTP GTP Which of the following is a nucleoside? Both A and C Which of the following is heterocyclic? C (has a Nitrogen) A major component of RNA but not DNA is: AMP GMP UMP CMP TMP UMP On the following molecule, which letter (A, B, C, D, or E) indicates the nucleotide base? A (Short answer) One strand of a double-helical DNA has the sequence (5')GCGCAATATTCTCAAAATAT(3'). A) Write the base sequence of the complementary strand. B) Explain what complementary means in nucleic acid chemistry. A. (3')CGCGTTATAAGAGTTTTATA(5') B. The nucleotide sequences of complementary strands are such that, whenever an A occurs in one strand, there is a T in the other strand with which it can form a hydrogen bonded base pair. Whenever a C occurs in one strand, a G occurs in the other. A is the base that is complementary to T, and C is the base complementary to G. (Short answer) DNA can form a double helix. Describe how noncovalent interactions contribute to the three-dimensional shapes and structures of the helix. Hydrogen bonding in regions of complementarity between DNA chains results in the formation of the natural helical structure. The complementary base pairing of A-T and G-C permit H-bonds to form. (Short answer) In one sentence, identify the most obvious similarity between the A-form of DNA and the B-form of DNA. Both A and B form a right-handed helix. n nucleic acid chemistry, compounds that contain an organic nitrogen-containing base and a sugar are called ____A_____. Two pyrimidine found in DNA in are _____B____ and ____B____. A pyrimidine found in all DNA but not in RNA is ____C_____. In DNA, the pair ____D_____ is held together by two hydrogen bonds. In RNA, the pentose ______E______ serves as the monosaccharides. A) Nucleosides B) Cytosine and Thymine C) Thymine D) A-T E) Ribose (Short answer) The monomers of DNA nucleic acids, called nucleotides, consist of three parts. What are those three parts? (Give three) phosphoric acid, deoxyribose (a pentose sugar), and an organic base.