ASCP MB Certification Final Exam Questions Comprehensive Resource To Help You Ace Exams Includes Frequently Tested Questions With ELABORATED 100% Correct COMPLETE SOLUTIONS Guaranteed Pass First Attempt!! Current Update!!

ASCP MB Certification
Final Exam Questions Comprehensive Resource To Help
You Ace 2026-2027 Exams Includes Frequently Tested
Questions With ELABORATED 100%
Correct COMPLETE SOLUTIONS
Guaranteed Pass First Attempt!! Current Update!!



1. Splicing is the process that does which of the following?
A. Remove exons and preserve introns?
B. Remove introns and preserve exons?
C. Remove mutated regions of primary transcript RNA (tRNA)?
D. Add a poly-A tail to the end of a primary RNA transcript? - Correct
Answer: Remove introns and preserve exons?


2. The phrase "central dogma of molecular biology" refers to the flow of
genetic data in this manner:
A. DNA --> RNA --> Proteins
B. DNA -->Proteins --> Genes
C. RNA --> DNA --> Proteins
D. RNA --> Proteins --> DNA - Correct Answer: DNA --> RNA -->
Proteins


3. What gene is measured following treatment with imatinib (Gleevec)?
A. FLT3
B. BCR/Abl
C. Jak2
D. MAPK - Correct Answer: BCR/Abl

,4. You have sequenced a gene and observe the following:
Reference: atgctggcacgacaggtttcccgactgg
Sequenced: atgCTGctggcacgacaggtttcccgactgg
The mutation observed is a:
A. Frame-shift mutation
B. Insertion
C. Silent mutation
D. Non-conservative mutation - Correct Answer: Insertion


5. What does the MSI test detect?
A. Microsatellite instability
B. Methicillin resistant Staphylococcus Infection
C. Gene duplications
D. Transposons - Correct Answer: Microsatellite instability


6. The sugar in DNA is:
A. Sucrose
B. Deoxyribose
C. Dextrose
D. Ribose - Correct Answer: Deoxyribose


7. What stain binds to minor groove of DNA Duplex?
A. SYBR1
B. EtBR
C. Propidium iodide
D. Methyl green - Correct Answer: SYBR1


8. Which of the following is not a probe-labeling method?
A. Labeling by random priming

, B. Labeling by nick translation
C. End-labeling (using a terminal transferase enzyme)
D. Labeling by hybrid capture - Correct Answer: Labeling by hybrid
capture


9. What is the name of the molecule that is added to the 5' end of eukaryotic
RNA transcripts?
A. ATP
B. SnRNP
C. GTP
D. Phosphate - Correct Answer: GTP


10.A technologist uses the spectrophotometer to quantify the amount of DNA
extracted from a blood specimen diluted 1:30. The absorbance reading at
260 nm was found to be 2.545. The concentration of DNA in this extract is:
A. 76.35 micrograms/mL
B. 3817.5 micrograms/mL
C. 381.75 micrograms/mL
D. 3054.0 micrograms/mL - Correct Answer: 3817.5 micrograms/mL


11.This enzyme is known for "unzipping" genes!
A. Alkaline Phosphatase
B. RNA polymerase
C. Apyrase
D. Helicase - Correct Answer: Helicase


12.What translocation is associated with Burkitt's lymphoma?
A. t(18;14)
B. t(9;22)

, C. t(8;14)
D. t(15;17) - Correct Answer: t(8;14)


13.Which of the following is not a step in the Southern blot procedure?
A. DNA digest with restriction enzymes
B. Gel resolution of fragments
C. Fragments denaturation
D. Probe digest - Correct Answer: Probe digest


14.You have sequenced a gene and observe the following:
Reference: atgctggcacgacaggtttcccgActgg
Sequenced: atgctggcacgacaggtttcccgCctgg
The mutation observed is a:
A. Frame-shift mutation
B. Insertion
C. Silent mutation
D. Non-conservative mutation - Correct Answer: Silent mutation


15.Primer dimers are due to what complimentary issue?
A. 3' to 3' complementarity of primer pairs
B. 3' to 5' complementarity of primer pairs
C. 5' to 5' complementarity of primer pairs
D. 5' to 3' complementarity of primer pairs - Correct Answer: 3' to 3'
complementarity of primer pairs


16.Police was called to a crime scene, where an elderly man was robbed and
fatally shot. Two eyewitness have each identified a different suspect whom
they claim to have seen flee the crime scene moments after hearing
gunshots. Police have obtained evidence from the crime scene, and the two