ASCP MB Certification
Final Exam Questions Comprehensive Resource To Help
You Ace 2026-2027 Exams Includes Frequently Tested
Questions With ELABORATED 100%
Correct COMPLETE SOLUTIONS
Guaranteed Pass First Attempt!! Current Update!!
1. This polymerase acts on DNA and produces Ribosomal RNA:
a) RNA Pol I
b) DNA Pol I
c) RNA Pol II
d) DNA Pol II - Correct Answer: RNA Pol I
2. Sickle cell disease is an autosomal genetic disease due to a point mutation in the beta-globin
gene, where glutamic acid is substituted for valine at the sixth codon of the gene, resulting in a
faulty hemoglobin S (Hb S). Sickle cell disease is one of many genetic diseases where a single
gene controls the expression of many phenotypic traits. The phenomenon where a single gene
controls the expression of many phenotypic traits is best referred to as:
- Correct Answer: Pleiotrophy
3. What assay amplifies the target using a combination of a three-enzyme system?
a) Branched DNA
b) TMA
c) PCR
d) NASBA
e) LCR - Correct Answer: NASBA
4. In what part of a qPCR Amplification Plot do you take your measurement? - Correct
Answer: Exponential phase
,5. All of the following are liquid tumors, except:
a) Mantle cell lymphoma
b) Ewing sarcoma
c) Burkitt's lymphoma
d) Acute promyelocytic leukemia - Correct Answer: Ewing sarcoma
6. A technologist uses the spectrophotometer to quantify the amount of DNA extracted from
a blood specimen diluted 1:30. The absorbance reading at 260 nm was found to be 2.545. If
the absorbance at 280 nm gave a reading of 1.406, and if the the DNA extract was re-
suspended in 0.800 mL of EDTA solution, the DNA yield is: - Correct Answer: (2.545 *
50ng/mcl)= 127.25
(127.25ng/mcl * 0.30) = 38.175ng/mcl
38.175ng/mcl ( 0.800mL1000) =
3054 micrograms
7. According to the wobble hypothesis, a U in the 5' position of the anit-codon can pair with:
a) U or C
b) A or G
c) A, C or G
d) Only A - Correct Answer: A or G
8. This polymerase acts on DNA and produces Messenger RNA: - Correct Answer: RNA Pol
II
9. What assay amplifies the probe signal and the probe RNA concentration increases if the
target to be detected is present?
Branched DNA
a) TMA
b) PCR
c) NASBA
, d) LCR
e) Qβ replicase - Correct Answer: Qβ replicase
10. This restriction enzyme "digests and adds a methyl group from Adenine":
a) Type I
b) Type II
c) Type III
d) DNase I - Correct Answer: Type III
11. What increases the half-life of mRNA?
a) 5' Methyl Cap
b) 3' Methyl Cap
c) Poly-A tail
d) 5' Methionine Cap - Correct Answer: 5' Methyl Cap
12. A parent has an autosomal dominant disorder. What percent chance does this parent have
to pass down this affected gene to his/her child?
a) 0%
b) 25%
c) 50%
d) 75%
e) 100% - Correct Answer: 50%
13. The phrase "central dogma of molecular biology" refers to the flow of genetic data in this
manner:
a) DNA --> RNA --> Proteins
b) DNA -->Proteins --> Genes
c) RNA --> DNA --> Proteins
d) RNA --> Proteins --> DNA - Correct Answer: DNA --> RNA --> Proteins
14. What drug is NOT metabolized by CYP2D6?
a) Codeine
, b) Omeprazole
c) Warfarin
d) Escitalopram - Correct Answer: Warfarin
15. You have sequenced a gene and observe the following:
Reference: atgctggcacgacaggtttcccgactgg
Sequenced: atgCctggcacgacaggtttcccgactgg
The mutation observed is a:
a) Frame-shift mutation
b) Insertion
c) Silent mutation
d) Non-conservative mutation - Correct Answer: Frame-shift mutation
16. A parent has an autosomal recessive disorder. What percent chance does this parent have to
pass down this affected gene to his/her child?
a) 0%
b) 25%
c) 50%
d) 75%
e) 100% - Correct Answer: 100%
17. Which DNA polymerase is responsible for copying DNA by reading existing strand, building
new complementary strand and always adds to 3' end, but can't start a new strand on its own
(ORI sites)?
a) DNA Polymerase III
b) DNA Polymerase I
c) Gyrase
d) None of the choices listed - Correct Answer: DNA Polymerase III
18. How many log10 reductions in HIV viral load is considered to be successful upon treatment?
Final Exam Questions Comprehensive Resource To Help
You Ace 2026-2027 Exams Includes Frequently Tested
Questions With ELABORATED 100%
Correct COMPLETE SOLUTIONS
Guaranteed Pass First Attempt!! Current Update!!
1. This polymerase acts on DNA and produces Ribosomal RNA:
a) RNA Pol I
b) DNA Pol I
c) RNA Pol II
d) DNA Pol II - Correct Answer: RNA Pol I
2. Sickle cell disease is an autosomal genetic disease due to a point mutation in the beta-globin
gene, where glutamic acid is substituted for valine at the sixth codon of the gene, resulting in a
faulty hemoglobin S (Hb S). Sickle cell disease is one of many genetic diseases where a single
gene controls the expression of many phenotypic traits. The phenomenon where a single gene
controls the expression of many phenotypic traits is best referred to as:
- Correct Answer: Pleiotrophy
3. What assay amplifies the target using a combination of a three-enzyme system?
a) Branched DNA
b) TMA
c) PCR
d) NASBA
e) LCR - Correct Answer: NASBA
4. In what part of a qPCR Amplification Plot do you take your measurement? - Correct
Answer: Exponential phase
,5. All of the following are liquid tumors, except:
a) Mantle cell lymphoma
b) Ewing sarcoma
c) Burkitt's lymphoma
d) Acute promyelocytic leukemia - Correct Answer: Ewing sarcoma
6. A technologist uses the spectrophotometer to quantify the amount of DNA extracted from
a blood specimen diluted 1:30. The absorbance reading at 260 nm was found to be 2.545. If
the absorbance at 280 nm gave a reading of 1.406, and if the the DNA extract was re-
suspended in 0.800 mL of EDTA solution, the DNA yield is: - Correct Answer: (2.545 *
50ng/mcl)= 127.25
(127.25ng/mcl * 0.30) = 38.175ng/mcl
38.175ng/mcl ( 0.800mL1000) =
3054 micrograms
7. According to the wobble hypothesis, a U in the 5' position of the anit-codon can pair with:
a) U or C
b) A or G
c) A, C or G
d) Only A - Correct Answer: A or G
8. This polymerase acts on DNA and produces Messenger RNA: - Correct Answer: RNA Pol
II
9. What assay amplifies the probe signal and the probe RNA concentration increases if the
target to be detected is present?
Branched DNA
a) TMA
b) PCR
c) NASBA
, d) LCR
e) Qβ replicase - Correct Answer: Qβ replicase
10. This restriction enzyme "digests and adds a methyl group from Adenine":
a) Type I
b) Type II
c) Type III
d) DNase I - Correct Answer: Type III
11. What increases the half-life of mRNA?
a) 5' Methyl Cap
b) 3' Methyl Cap
c) Poly-A tail
d) 5' Methionine Cap - Correct Answer: 5' Methyl Cap
12. A parent has an autosomal dominant disorder. What percent chance does this parent have
to pass down this affected gene to his/her child?
a) 0%
b) 25%
c) 50%
d) 75%
e) 100% - Correct Answer: 50%
13. The phrase "central dogma of molecular biology" refers to the flow of genetic data in this
manner:
a) DNA --> RNA --> Proteins
b) DNA -->Proteins --> Genes
c) RNA --> DNA --> Proteins
d) RNA --> Proteins --> DNA - Correct Answer: DNA --> RNA --> Proteins
14. What drug is NOT metabolized by CYP2D6?
a) Codeine
, b) Omeprazole
c) Warfarin
d) Escitalopram - Correct Answer: Warfarin
15. You have sequenced a gene and observe the following:
Reference: atgctggcacgacaggtttcccgactgg
Sequenced: atgCctggcacgacaggtttcccgactgg
The mutation observed is a:
a) Frame-shift mutation
b) Insertion
c) Silent mutation
d) Non-conservative mutation - Correct Answer: Frame-shift mutation
16. A parent has an autosomal recessive disorder. What percent chance does this parent have to
pass down this affected gene to his/her child?
a) 0%
b) 25%
c) 50%
d) 75%
e) 100% - Correct Answer: 100%
17. Which DNA polymerase is responsible for copying DNA by reading existing strand, building
new complementary strand and always adds to 3' end, but can't start a new strand on its own
(ORI sites)?
a) DNA Polymerase III
b) DNA Polymerase I
c) Gyrase
d) None of the choices listed - Correct Answer: DNA Polymerase III
18. How many log10 reductions in HIV viral load is considered to be successful upon treatment?
