BIO 235 Final Exam | Q&A Study Guide | 2026 |
100% Verified | A+ Pass
What category of transposable elements use an RNA copy of their genome in the
process of transposition?
A. Cut-and-paste transposons
B. Composite bacterial transposons
C. Bacterial insertion sequences
D. Retrotransposons
E. Multiple drug resistance plasmids -✓✓D
Copy-and-paste transposons a.k.a. replicative transposition -✓✓A new copy of the
transposable element is introduced at a new site while the old copy remains behind at
the original site (so the number of copies of the transposable element increases)
Transposons a.k.a. transposable elements -✓✓Sequences that can move about in the
genome and are often a cause of mutations
Are direct repeats part of a transposon? -✓✓NO
Are inverted repeats part of a transposon? -✓✓YES
Transposition -✓✓The movement of a transposon
Cut-and-paste transposons a.k.a. nonreplicative transposition -✓✓Transposable
element excises from the old site and inserts at a new site WITHOUT any increase in
the number of its copies
Retrotransposons -✓✓Elements that transpose through an RNA intermediate
Mutagenic compounds that fit and "get stuck" between nucleotides of DNA molecules
are called ________, whereas mutagenic compounds that cause the covalent
attachment of a methyl or an ethyl group to bases of DNA are called ______.
A. De-aminating agents; reactive oxygen molecules
B. Oxidizing agents; glycosylases
C. Intercalating agents; alkylating agents
D. Hydrolases; base analogs
E. Catalytic converters; organic solvents -✓✓C
Base analogs -✓✓Chemicals with structures similar to that of any of the four standard
bases of DNA (DNA polymerase canNOT distinguish these analogs from the standard
bases)
,Alkylating agents -✓✓Chemicals that donate alkyl groups like methyl and ethyl groups
Deamination -✓✓Removing an amino group
Intercalating agents -✓✓Produce mutations by sandwiching themselves (intercalating)
between adjacent bases in DNA, distorting the three-dimensional structure of the helix
and causing single-nucleotide insertions and deletions in replication
What form of radiation causes double-strand breaks in DNA? -✓✓X-rays (ionizing
radiation)
What form of radiation forms pyrimidine dimers (or thymine dimers)? -✓✓UV rays
Pyrimidine dimers -✓✓Formation of a chemical bond between adjacent pyrimidine
molecules on the same strand of DNA
Depurination -✓✓The loss of a purine base from a nucleotide
How many amino acids are encoded in the following RNA sequence?
5' - AUGCCUGAAUGGGCUUUAUGA - 3'
A. 3
B. 4
C. 5
D. 6
E. 7 -✓✓D (there is no amino acid for a stop codon)
What feature of the polypeptide chain determines the secondary structure of proteins?
A. The last carboxyl group
B. The first amino group
C. Intra-molecular hydrogen bonding among amino acid units that induces the formation
of alpha-helices and beta-pleated-sheets
D. Interactions among the components of multi-protein complex
E. The hinge regions that allow the alpha-helices and beta-pleated-sheets to fold in
space -✓✓C
Primary structure of a protein -✓✓Sequence of amino acids
Secondary structure of a protein -✓✓Interactions between neighboring amino acids
causing a polypeptide chain to fold and twist (alpha helix and beta pleated sheet -
regional folding)
Tertiary structure of a protein -✓✓Overall-three dimensional shape of the protein (when
secondary structures fold even further)
, Quaternary structure -✓✓When two or more polypeptide chains associate
When codons that specify the same amino acid differ in ________, a single tRNA may
be able to anneal to several of them through wobble base pairing.
A. Any one of their nucleotides
B. Any two or their nucleotides
C. Their 5' nucleotide
D. Their middle nucleotide
E. Their 3' nucleotide -✓✓E (wobble takes place on the THIRD position of a codon and
the FIRST position of the anticodon)
Where does wobble take place on the codon? (5' end or 3' end?) -✓✓3' end (third
position)
Where does wobble take place on the anticodon? (5' end or 3' end?) -✓✓5' end (first
position)
Through wobble, a single __________ can pair wit more than one __________.
A. codon; anticodon
B. group of three nucleotides in DNA; codon in mRNA
C. tRNA; amino acid
D. Anticodon; codon -✓✓D
The increase in number (expansion) of three-nucleotide repeats is responsible for?
A. Sickle-cell anemia
B. Xeroderma pigmentosum
C. Alkaptonuria
D. Trisomy 21
E. Fragile X syndrome
F. None of the above -✓✓E
How many copies of the CGG repeat does a normal/unaffected person? (fragile X
syndrome) -✓✓Less than 55 (60)
How many copies of the CGG repeat does a premutated individual have? (fragile X
syndrome) -✓✓55-230
How many copies of the CGG repeat does an affected individual have? (fragile X
syndrome) -✓✓more than 230
Are somatic mutations inherited? -✓✓NO (produce patches - basis for cancers)
Are germ-line mutations inherited? -✓✓YES
100% Verified | A+ Pass
What category of transposable elements use an RNA copy of their genome in the
process of transposition?
A. Cut-and-paste transposons
B. Composite bacterial transposons
C. Bacterial insertion sequences
D. Retrotransposons
E. Multiple drug resistance plasmids -✓✓D
Copy-and-paste transposons a.k.a. replicative transposition -✓✓A new copy of the
transposable element is introduced at a new site while the old copy remains behind at
the original site (so the number of copies of the transposable element increases)
Transposons a.k.a. transposable elements -✓✓Sequences that can move about in the
genome and are often a cause of mutations
Are direct repeats part of a transposon? -✓✓NO
Are inverted repeats part of a transposon? -✓✓YES
Transposition -✓✓The movement of a transposon
Cut-and-paste transposons a.k.a. nonreplicative transposition -✓✓Transposable
element excises from the old site and inserts at a new site WITHOUT any increase in
the number of its copies
Retrotransposons -✓✓Elements that transpose through an RNA intermediate
Mutagenic compounds that fit and "get stuck" between nucleotides of DNA molecules
are called ________, whereas mutagenic compounds that cause the covalent
attachment of a methyl or an ethyl group to bases of DNA are called ______.
A. De-aminating agents; reactive oxygen molecules
B. Oxidizing agents; glycosylases
C. Intercalating agents; alkylating agents
D. Hydrolases; base analogs
E. Catalytic converters; organic solvents -✓✓C
Base analogs -✓✓Chemicals with structures similar to that of any of the four standard
bases of DNA (DNA polymerase canNOT distinguish these analogs from the standard
bases)
,Alkylating agents -✓✓Chemicals that donate alkyl groups like methyl and ethyl groups
Deamination -✓✓Removing an amino group
Intercalating agents -✓✓Produce mutations by sandwiching themselves (intercalating)
between adjacent bases in DNA, distorting the three-dimensional structure of the helix
and causing single-nucleotide insertions and deletions in replication
What form of radiation causes double-strand breaks in DNA? -✓✓X-rays (ionizing
radiation)
What form of radiation forms pyrimidine dimers (or thymine dimers)? -✓✓UV rays
Pyrimidine dimers -✓✓Formation of a chemical bond between adjacent pyrimidine
molecules on the same strand of DNA
Depurination -✓✓The loss of a purine base from a nucleotide
How many amino acids are encoded in the following RNA sequence?
5' - AUGCCUGAAUGGGCUUUAUGA - 3'
A. 3
B. 4
C. 5
D. 6
E. 7 -✓✓D (there is no amino acid for a stop codon)
What feature of the polypeptide chain determines the secondary structure of proteins?
A. The last carboxyl group
B. The first amino group
C. Intra-molecular hydrogen bonding among amino acid units that induces the formation
of alpha-helices and beta-pleated-sheets
D. Interactions among the components of multi-protein complex
E. The hinge regions that allow the alpha-helices and beta-pleated-sheets to fold in
space -✓✓C
Primary structure of a protein -✓✓Sequence of amino acids
Secondary structure of a protein -✓✓Interactions between neighboring amino acids
causing a polypeptide chain to fold and twist (alpha helix and beta pleated sheet -
regional folding)
Tertiary structure of a protein -✓✓Overall-three dimensional shape of the protein (when
secondary structures fold even further)
, Quaternary structure -✓✓When two or more polypeptide chains associate
When codons that specify the same amino acid differ in ________, a single tRNA may
be able to anneal to several of them through wobble base pairing.
A. Any one of their nucleotides
B. Any two or their nucleotides
C. Their 5' nucleotide
D. Their middle nucleotide
E. Their 3' nucleotide -✓✓E (wobble takes place on the THIRD position of a codon and
the FIRST position of the anticodon)
Where does wobble take place on the codon? (5' end or 3' end?) -✓✓3' end (third
position)
Where does wobble take place on the anticodon? (5' end or 3' end?) -✓✓5' end (first
position)
Through wobble, a single __________ can pair wit more than one __________.
A. codon; anticodon
B. group of three nucleotides in DNA; codon in mRNA
C. tRNA; amino acid
D. Anticodon; codon -✓✓D
The increase in number (expansion) of three-nucleotide repeats is responsible for?
A. Sickle-cell anemia
B. Xeroderma pigmentosum
C. Alkaptonuria
D. Trisomy 21
E. Fragile X syndrome
F. None of the above -✓✓E
How many copies of the CGG repeat does a normal/unaffected person? (fragile X
syndrome) -✓✓Less than 55 (60)
How many copies of the CGG repeat does a premutated individual have? (fragile X
syndrome) -✓✓55-230
How many copies of the CGG repeat does an affected individual have? (fragile X
syndrome) -✓✓more than 230
Are somatic mutations inherited? -✓✓NO (produce patches - basis for cancers)
Are germ-line mutations inherited? -✓✓YES
