Geschreven door studenten die geslaagd zijn Direct beschikbaar na je betaling Online lezen of als PDF Verkeerd document? Gratis ruilen 4,6 TrustPilot
logo-home
Tentamen (uitwerkingen)

Exam (elaborations) Biology 1 (Biology1) Biology 1 Final Exam Review (GRADED A) Questions and Answer solution.

Beoordeling
-
Verkocht
-
Pagina's
24
Cijfer
A+
Geüpload op
21-02-2022
Geschreven in
2021/2022

Biology 1 Final Exam Exam 1 1. When making a list about the primary elements of life, which of the following would not be included? - Hydrogen - Oxygen - Carbon - Nitrogen - Phosphorus - Sul fur 2. From the options below, identify the list that has these functional groups: methyl, phosphate, and hydroxyl. (Note the lists may not be in that order). - Methyl Group: (1 Carbon Atom bonded to 3 Hydrogen Atoms) - Phosphate Group: (1 Phosphorus Atom bonded to 4 Oxygen Atoms in a Tetrahedral arrangement) - Hydroxyl Group: (1 oxygen covalently bonded to 1 hydrogen) 3. Cell walls are composed of a material that is classified as a: - Cellulose a polysaccharide 4. Estrogen is a steroid derived hormone, what type of biological material is used in the creation of steroid hormones? - Cholesterol (a Lipid) 5. Energy is vital to the cell and central to cellular processes, which type of biological molecule can be used for the generation of energy? - Carbohydrates 6. Microtubules, actin, and intermediate filaments are all found in cells. They are responsible for a number of activities. Which of the following is not an activity performed by those three materials? - Microtubules: support, cell division (separation of chromosomes), cell/organelle movement - Actin: Forms microfilaments, cell movement, signaling, muscle contraction, cell junctions - Intermediate Filaments: support 7. All cells possess this structure that isolates them from the environment: - Plasma membrane - Phospholipid bilayer 8. Considering all the properties that are used to define life, which of the following is not one of the properties? - Life is Isolated - Has to be a barrier that separates it from its environment - Life is Complex and Ordered - Life is not at equilibrium - Life at equilibrium is dead - Life is regulated - Life is responsive - Life grows and reproduces - Life is well adapted (this is subjective) - Life requires and uses energy - Life carries instructions DNA/RNA produces the instructions for things life needs for the living thing to do all of the above 9. (A = True / B = False) The inherent difficulty of studying biology, is that each part of the hierarchy from cells to ecosystems is entirely different in structure and themes. - False 10. In examining the tree of life as it is theorized to have occurred from a common cellular ancestor, we would see something interesting and that is: - An early prokaryotic cell as the precursor to all cells 11. (A = True / B = False) The concept of evolution is still under debate in the scientific community, this demonstrates that all topics in science are open for discussion! - False 12. In 1953, Miller tested a hypothesis exploring the idea of the “primordial conditions” of Earth. During this experiment in which he created a “sea” and an “atmosphere” he electrified the atmosphere to simulate lightning as a result what was created? - Organic molecules 13. On what hierarchical level of biology does evolution occur? - Population 14. All of the elements of life first originated in - Exploding stars 15. Which of the following statements about atoms is true? - Definition of an atom 16. What is an ion? - an atom or molecule with a net electric charge due to the loss or gain of one or more electrons. 17. Most elements of life are more stable when they have how many electrons in their outermost shell? - 8 electrons in valence shell 18. In a covalent bond… - Electrons are shared between atoms 19. Oxygen will form covalent bonds and carbon will form covalent bonds. - Oxygen:2 - Carbon:4 20. (A = True / B = False) Water is a charged molecule. - True 21. Hydrogen has essentially the same electronegativity as… - Carbon 22. Which molecule, listed below, shows polar bonds? - 23. (A = True / B = False) Ionic bonds are similar to electrostatic interactions, but they differ in that electrostatic interactions are created by the transfer of electrons from one atom to another. - False 24. Which of the following would be the most stable? - 25. How many atoms are in 2 moles of water molecules? - (6.02 x 10^23) 6 - 36.14 26. (A = True / B = False) If a mole of Fluorine weighs approximately 19g, then the atomic mass of fluorine is 19 daltons. - true 27. 0.5 mol of sucrose in 0.5 L if water is equal to what molarity? - 1 28. Acids release that can be picked up by a(n) . - Release protons - Base 29. In neutral water the concentration of hydroxide is: - 7 30. Water with a hydroxide concentration of 10-11 is what pH? - 10-11 31. These materials resist pH changes: - buffers 32. As the pH of a system decreases, the concentration of hydrogen ion: - increases 33. Why has vitalism been rejected a scientific model? - Because organic compounds have been found/made from non organic compounds 34. In complex organic molecules, what purposes do function groups serve? - Functional groups in biological molecules play an important role in the formation of molecules like DNA, proteins, carbohydrates, and lipids. - Shape is important for different reactions 35. Carboxyl groups are and amine groups are . - Carboxyl’s Acids - Amines Bases 36. Rank these in order of size: (1) monomer, (2) polymer, (3) dimer, (4) oligo. - Monomer Dimer Oligo Polymer 37. By weight, what is the most abundant material in the cell? - Proteins 38. In a cell, the creation of larger macromolecules is driven by this reaction that splits out a water molecule from two reacting species. - Dehydration 39. In a cell, larger macromolecules are broken down into constituent parts by this reaction that consumes a water molecule. - Hydrolysis 40. (A = True / B = False) Glucose is a common disaccharide in the diet. - false 41. Lipid polymers that are will likely be liquids at room temperature. - Unsacharated 42. What is the omega number of this fatty acid? HO2C-CH2-CH2-CH=CH-CH2-CH2-CH2-CH3 - Five 43. A phospholipid has an unusual solubility property, what is it? - are amphipathic will interact with both aqueous solution and hydrophobic solutions 44. ARG is what type of amino acid? - Positive 45. Which of the following lists shows only hydrophobic amino acids? - Glycine - Alanine - Valine - Leucine - Isoleucine - Methionine - Phenylalanine - Tryptophan - Proline 46. Amino acids are polymerized by what type of bond? - Hydrogen 47. Alpha helices, beta sheets, and random coils are found in what level of protein structure? - 1 Degree 48. In a cell, which of the following is not a role for nucleic acids? - information storage (genes) polynucleotides - enzymes - molecular adaptor - energy source - cell signaling - chemical rxns - 49. Proteins are polymerized in the and nucleic acids are polymerized in the . - Ribosomes/Rough ER - Nucleus 50. Which of the following distinguishes DNA and RNA from each other? - RNA-Uracil DNA-Thymine - DNA Double Helix and self replicating RNA-Single strand not self replicating - RNA Sugar: Ribose DNA Sugar DeoxyRibose Exam 2 1) Which of the following statements differentiates eukaryotes from prokaryotes? • Eukaryotes have a nucleus a membrane bound organelle where DNA is stored • Eukaryotes are generally larger than prokaryotes • Prokaryotes have no nucleus just an area where their DNA is concentrated called the nucleoid 2) What structure do plant cells possess that is shared by prokaryotes but animal cells do not possess? • Cell walls 3) Where are secreted proteins synthesized in a eukaryotic cell? • Rough ER 4) (True / False) The (HIDDEN) ER is responsible for calcium storage, fatty acid synthesis, and detoxification of dangerous compounds. • Smooth ER 5) Pancreatic cells are responsible for (HIDDEN). Therefore, pancreatic cells are expected to be rich in: • Protein secretion • Ribosomes 6) Consider a material like collagen that is used outside of the cell to create extracellular matrix. The list below shows all the steps involved (out of order) select the answer that places the steps in order correctly. • Protein synthesis by bound ribosomes in ER • Reshaped/packaged • Sent to Golgi • Sent out from trans face of Golgi as transport vesicle to plasma membrane • Used in plasma membrane • Or released by cell 7) (True / False) Lysosomes receive their enzymes and digestion materials from the (HIDDEN) via merging with vesicles that formed from the clathrin system. • Rough ER synthesis - Golgi for packaging- transport vesicle 8) What is the purpose of the endomembrane system (EMS)? • The Synthesis and Transport of proteins into membrane/organelles or out of the cell • Movement of lipids • Detox of toxins 9) In the cytoskeleton (HIDDEN) are made of ( ), (HIDDEN) are made of ( ), and (HIDDEN) are made of ( ). • Microfilaments are made up of Actin • Intrafilaments are made up of Keratins • Microtubules are made up of Tubulin 10) Which of the following is NOT a function of a (HIDDEN CYTOSKELETAL ELEMENT)? • Microtubules- Maintenance of cell shape/cell motility/ chromosome movements/Organelle movements • Microfilaments- Maintenance of cell shape/changes in cell shape/muscle contraction/cytoplasmic streaming in plant cells/ cell motility/division of animal cells • Intermediate filaments- Maintenance of cell shape/ anchorage of nucleus and certain other organelles/ formation of nuclear lamina 11) (True / False) Intermediate filaments give shape and support to the nucleus of the cell. • True 12) Which of the following is NOT true of a (HIDDEN)? • ? there is no way to know hidden is 13) What best describes membrane lipids? • Amphipathic? 14) What type of membrane protein is associated with the membrane and other membrane proteins through non-covalent interactions? • Peripheral proteins 15) Considering the properties of osmosis, a cell is place in a isotonic solution. What happens to the cell? • Water will diffuse in and out at a constant rate 16) Compared to a solution of pure water, what is the tonicity of the cell? • High tonicity • Hypotonicity 17) What is the role of cholesterol in membrane behavior? • Cholesterol helps maintain membrane fluidity and integrity/aids in signaling and helps secure proteins • At high temperatures it reduces membrane fluidity • At low temperatures it keeps it from solidifying For the questions in this box use the following answers 18) The plasma membrane is permeable to water. 19) The plasma membrane is permeable to CO2. 20) The plasma membrane is impermeable to Na+. 21) The plasma membrane is impermeable to benzene. 22) The plasma membrane is impermeable to glucose. 23) Which type of transport could be used to move a charged material that has higher concentration outside of the cell to the inside of the cell? • Facilitated Diffusion 24) What differentiates phagocytosis from receptor mediated endocytosis (RCM)? • Phagocytosis-Engulfing smaller organisms or food particles in a food vacuole (non specific) • Endocytosis cell takes in molecules and particulates matter by forming new vesicles from the plasma membrane (very specific to cells needs) 25) What are three of the types of junctions that connect cells to each other? • Desmosomes -Anchoring junctions • Gap Junctions- Communicating Junctions allow things to travel between the cells • Tight Junctions- Act as barriers that regulate movement of water in between cells 26) ( ) reactions release energy for ( ) reactions. • Exergonic reactions release energy for Endergonic reactions 27) (True / False) The first law of thermodynamics is (HIDDEN). • Energy cannot be created or destroyed only transferred or transformed 28) (True / False) The second law of thermodynamics is (HIDDEN). • Disorder (entropy) of the Universe increases 29) You determine a reaction to possess a free energy of -5.43 kcal/mol, this reaction can be classified as: • Exergonic/catabolic 30) Two reactions (1 and 2) are compared and (1) has a much greater free energy than (2). Therefore, when discussing rates of reaction: • Delta G cannot tell us anything about the rate of the reaction 31) Which of the following describes why ATP is energy rich? • Because of its negatively charged phosphate groups • The energy Hydrolyzed ATP releases on losing a phosphate group is somewhat greater than the energy most other molecules could deliver 32) (True / False) A reaction that has a free energy of (HIDDEN) kcal/mol can be paid for by the energy released from ATP hydrolysis? • Greater than 7.3 false • Less than 7.3 true 33) Which of the following statements about enzymes is NOT true?*** • Enzymes don’t reduce activation energy they make a new one that has a lower activation energy they do not actually change it 34) (True / False) Only biological reactions that involve breaking bonds require energy. • False 35) Measuring the free energy of a system you determine that the ΔG is 0 kcal/mol. From this you determine: • The system is at equilibrium For the questions in this box, choose from these answers (answers may be used more than once): 36) What is the site where feedback regulation takes place? • Allosteric site 37) What type of inhibitor could include the product of the reaction? • Competitive inhibitor 38) What type of inhibitor will not respond to changes in substrate concentration? • Noncompetitive Inhibitor 39) What is the site where the inhibitor in question 37 would bind? • Active site 40) Which of the following is NOT a way enzymes aid in chemical reactions? The following are correct anything else is not a way enzymes aid in chemical reactions • Enzymes orient two substances • Put stress on bonds • Creates microenvironment 41) Which of the following would NOT affect the rate of an enzyme-catalyzed reaction? The Following are correct answers anything else is wrong • pH • Temperature • Substrate concentration • Enzyme concentration • Binding of regulatory molecules 42) In naming an enzyme what suffix is expected? • ASE ex hydrolase Exam 3 1. In General, how should energy cycle for life be described • Most life on Earth acquires ENERGY through photosynthesis, followed by cellular respiration. 2. Select the answer that correctly completes these sentences (note that all sentences relate to each other) • Compound 1 reduces compound 2 by transferring electrons to Compound 2 • Compound 2 is called a oxidizing agent • Compound 1 is called an reducing agent • Compound 2 oxidizes compound 1 3.(T/F) ATP synthesis is an Blank process made Blank by enzymes that preform substrate level phosphorylation • (True) ATP synthesis is an endergonic process • (False) made exergonic by enzymes that preform substrate level phosphorylation 4. Consider the electron carriers, which of the following statements is true? • When NAD+ is reduced its charge/energy is lowered and a H is added to it forming NADH • The enzymatic transfer of 2 electrons and 1 proton (H+) from an organic molecule in food to NAD+ reduces the NAD+ to NADH; the second proton (H+) is released. The enzyme involved is dehydrogenase • NADH is oxidized its electrons are released and its charge/energy is elevated • Little energy is lost • NADH FADH NADPH (photosynthesis only) donate their electrons 5. When considering the four stages of cellular respiration, which of the following statement is true? • Glycolysis- Occurs in Cytosol Glucose (6 Carbons) is broken down into 2 Pyruvate (3 Carbons) creates 4 ATP and consumes 2 ATP total net ATP of 2 also uses 2 NADH as electron transporters • Pyruvate Oxidation- 2 Pyruvate enter Mitochondrial Matrix 1 at a time and (3 Carbons) are oxidized (lose 2 carbons as CO2) to 2 Acetyl CoA (2 Carbons) Produces 2 NADH as electron transporter • Citric Acid Cycle- 2 Acetyl CoA (2 Carbons) combine with 2 oxaloacetates (4 Carbons) to form 2 Citrate (6 carbons) 2 Carbons are released as CO2 and reform oxaloacetate Generates 1 ATP (or GTP depending on Cell) for each Acetyl CoA (2 ATP in total) 3 NADH per Acetyl CoA (6 in total) 1 FADH2 per Acetyl CoA (2 FADH in total ) • Electron Transport Chain- electron carriers from Glycolysis/Pyruvate Oxidation/Citric Acid Cycle deposit electrons to power proton pumps (generates ATP indirectly via electrochemical gradient) occurs in mitochondrial membrane NADH releases electron (into transport chain to proton pump) and becomes NAD+. Produces O2 and Water as waste products. Produces nothing gets rid of electrons creates proton gradient • Oxidative Phosphorylation- In Mitochondrial Membrane Protons (H+) in proton power pumps move down their concentration gradient powering ATP Synthase (protein motor which moves protons through it generating ATP from ADP and Pi or Phosphate). A large amount of ATP is generated (End goal of cellular respiration) 6. Blank is preformed in the Blank while the TCA cycle is preformed in the Blank • Glycolysis is preformed in the cytosol while the TCA cycle is preformed in the Mitochondrial matrix. • Pyruvate Oxidation is preformed in the Mitochondrial Matrix while TCA is preformed in the Mitochondrial Matrix. • Electron Transport Chain is preformed in the Mitochondrial membrane while TCA is preformed in the mitochondrial matrix 7. WTF 8. What enzyme preforms the Blank of glycolysis • What enzyme preforms the phosphorylation of glycolysis? (Hexokinase) • What enzyme preforms the oxidation of glycolysis (Dehydrogenase) • What enzyme preforms the split of glycolysis (aldoase) 9. One of the main inputs of the TCA cycle is Acetyl-CoA assuming Blank of glucose is processed completely through to the TCA cycle then how many moles Acetyl-CoA will be generated • 1 Mole of glucose = 2 Moles of Acetyl CoA will be Produced 10. Assuming [HIDDEN] of glucose is processed completely through glycolysis to Acetyl-CoA and then all generated Acetyl-CoA are passed through the TCA cycle, how many electron carriers will be generated by the TCA cycle? • 4 per cycle • 2 cycles per glucose • 8 per glucose 11. Where does the energy come from to generate ATP in the Electron Transport Chain? • Electrochemical gradient (chemiosmosis) 12. Which of the following substances can inhibit the action of the rate limiting enzyme of glycolysis? • Phosphofructokinase 13. What is the sugar product of photosynthesis • G3P (Glyceraldehyde 3-Phosphate) 14. What is a stomata • Pores found in leaves, steams, and other organs that is used to control gas exchange • (allows CO2 to enter and oxygen to exit) 15. Photosynthesis is a bit different than the electron transport chain in mitochondria. What acts as the initial electron source for photosynthesis? • Water is split and electrons are transferred along with hydrogen ions 16. What is the purpose of Photosystem Blank? Photosystems purpose is to generate ATP and NADPH from light energy Photosystem 2 • Is the first protein complex in the light dependent reactions of photosynthesis • Primary electron acceptor • Absorbs P680 pigments • Absorbs Wavelength 680 • Hydrolysis of water • ATP synthesis Photosystem 1 • Is the second protein complex in the light dependent reactions of photosynthesis • Absorbs light of wavelength 700nm • ATP synthesis • Absorbs P700 pigments 17. (T/F) The thylakoid space is analogous to the mitochondrial matrix based on proteins present and direction of proton flow. In this case the protons would flow from the stroma to the thylakoid space; similar to the inter membrane space to the matrix • False (it occurs in stroma) • Thylakoid and mitochondrial matrix flow oppositely 18. What is purpose of Photosystem Blank? Photosystems purpose is to make ATP and NADPH Photosystem 2 • Is the first protein complex in the light dependent reactions of photosynthesis • Absorbs light of wavelength 680 • Absorbs P680 pigments • Hydrolysis of water • ATP synthesis Photosystem 1 • Is the second protein complex in the light dependent reactions of photosynthesis • Absorbs light of wavelength 700nm • Absorbs P700 pigments 19. Blank Calvin Cycle Blank? • CO2-Calvin Cycle- G3P 20. The act of converting CO2 into a sugar is termed: Calvin Cycle-Carbon Fixation • Takes 3 CO2 molecules around the cycle 1 at a time to make 1 sugar 21 The use of what reducing equivalent distinguishes photosynthesis from cellular respiration • NADH (cell respiration) • NADPH (photosynthesis) 22. What is the final electron acceptor in Blank • Cellular Respiration: Oxygen • Photosynthesis: NADP+ • Fermentation Pyruvate 23. Starting from one mole of glucose and assuming the entire mole of glucose goes through the entire glycolysis pathway and through ONE Turn of the TCA cycle. How many CO2 will be released? • 4 CO2 will be released • TCA usually runs twice and releases 4 • But 1 turn of TCA releases 2 24. Assuming a molecule of glucose is processed entirely through glycolysis. How many times will the energy harvesting phase be preformed? • Twice 25. T/F Prokaryotes divide by a process termed Blank • True Binary Fission The following questions in this box are concerned with only mitosis and meiosis. For each question choose from these answers (answers may be used more than once, or not at all): 26. In this system, there is a phase where the chromosomes will line up single file. • Both 27. In this system, there is a phase where the chromosomes will pair up by homologues. • Meiosis 28. In this system, there is a phase of DNA synthesis. • Neither 29. This system has only one round of nuclear division. • Mitosis 30. This system follows G2 phase of the cell cycle. • Mitosis (Meiotic phase) 31. In this system, the outcome should decrease genetic variation. • neither 32. In this system, the outcome should not change genetic variation. • Mitosis 33. Consider the figure to the right (labeled Figure 1), What phase of mitosis • See end of gift 34. Cell cycle is made of Blank phases, what are they? • 2= Interphase and miotic phase (mitosis and cytokenisis) • 4= G1 , S , G2, Meiotic phase • 5=G1 , S, G2, Mitosis, Cytokinesis 35. A Cell that is not actively dividing is in what phase of the cell cycle? • G0 36. In What phase of mitosis will the contractile ring appear • Telophase 37. (T/F) Sister chromatids are expected to be genetically Blank from each other • Identical = True • Distinct= False 38. What s the purpose of G (Blank) 2 phases which separate M and S • G1 Growth/prep for S phase • G2 more growth/prep for M phase 39. (T/F) Mitosis is a Blank system with phases defined by structural hallmarks • Reproductive (false) • Regeneration/Growth Repair (true) 40. A cell with Blank chromosomes undergoes mitosis, how many chromosomes will be in each daughter cell • Same number of chromosomes as daughter cell 41. A cell with Blank chromosomes undergoes meiosis, how many daughter cells will be produced? • 4 daughter cells 42. What is the definition of Homologous Chromosomes • chromosome PAIRS, carrying the same genes. • ONE of each pair is inherited from EACH parent • SO: each parent gives us ONE copy of a gene • the genes MAY NOT be identical! Ex: human eye color gene on chromosome 15; one parent may give BROWN, another BLUE. 43. WTF 44. A human male has Blank homologous chromosomes and a human female has Blank homologous chromosomes • Male 44 • Female 46 45. A mature human gamete is Blank and should have how many chromosomes? • Haploid cell • 23 46. Which cellular event will reduce the number of chromosomes by one-half • meiosis 2 47. Which of the following will not create genetic variation? • Mitosis and Binary fission 48. Meiosis occurs in… • Sexual reproductive organs 49. A cell that is terminally differentiated and not actively dividing is in what phase? • G0 50. During what phase of the cell cycle is DNA likely to be visible as Chromatin? • Prophase 33. part 1 33. Part 2 Exam 4 1) Which of the following did not contribute to Mendel developing his laws of inheritance? Knowledge of DNA and chromosomes 2) (A = True / B = False) It is well established that offspring must contain traits that [HIDDEN] one parent or the other. False if resemble True if originate 3) What word defines: “The genetic make-up of the organism”? genotype 4) What word defines: “The observable traits of an organism”? phenotype 5) Consider the following system: A red flowering pea plant and a blue flowering pea plant. When the red plant is bred with itself only red plants are produced. When the blue plant is bred with itself only blue plants are produced. It is unknown whether or not the red or blue trait is dominant. By generating an F1, if the [HIDDEN] trait is dominant what will the F1 generation of plants looking like? If red is dominant RR x rr F1 Generation will all be red If blue is dominant BB x bb F1 generation will all be blue 6) Consider the system from the previous question. What is the genotype of the F1 generation? (R = red allele, r = blue allele). If Red is dominant F1 will be Rr 7) Consider the system from question 5. If the [HIDDEN] color is dominant and the F1 generation is self-fertilized, then what color will the F2 generation be? RED is dominant 3:1 Red: Blue Blue is dominant 3:1 Blue to Red 8) Consider the system from question 5. As an experiment, you cross the F1 plants and see the following: 100 Red plants, 200 Purple plants, and 100 blue plants. What type of inheritance describes this observation? Incomplete Dominance 9) What cellular event maps to Mendel’s Law of [HIDDEN]? Mendel’s Law of Segregation Meiosis 2 Mendel’s Law of Independent Assortment Meiosis 1 10) What is the expected phenotypic ratio for two unlinked genes in a dihybrid cross? 9:3:3:1 11) What is a test cross? Dominant Phenotype (Unknown Genotype) vs. homozygous recessive 12) Given the following genotype AaBbCC, which of the following is a possible gamete from this organism? 4 possible ABC AbC aBC abC 13) (A = True / B = False) Traditionally, a [HIDDEN] allele does not produce a functional protein. Recessive alleles encode defective proteins True if Recessive False if Dominant 14) The human blood type system (ABO) is an example of what type of inheritance? codominance 15) During a paternity suit one party claims that the mother (Rosalind) has Blood Type A and the father (Gregor) has Blood Type B. Therefore, since the child is Blood Type [HIDDEN], the child could not be fathered by Gregor. Does this claim stand? No there is no way to rule it out 16) Which of the following defines “allele”? Allele: alternate version of a genes 17) A protein that generates a phenotype only at certain temperatures is an example of a(n) effect on the phenotype of an organism? Environmental 18) In hamsters, red fur (R) is dominant to white fur (r). Your friend gives you two red fur hamsters, and tells you that their mother had [HIDDEN] fur. Living in the cage together, you discover that one of your hamsters is now pregnant, and the other one had to have been the father! What is the genotype of your two hamsters, and what phenotypes do you expect to see from this mating? Rr x Rr Red to white 3:1 3 red 1 white 19) A woman with normal color vision is married to a man with red-green colorblindness, an X-linked recessive disorder. Their first child is a son who is color blind. What is the probability that their next child will be colorblind? 1/2 20) When two traits are “linked” this means: They are on the same chromosome Sex-linked gene – gene located on a sex chromosome 21) (A = True / B = False) Gene recombination (i.e. creating new combinations of traits not seen in either parent) can only be accomplished by crossing over during [HIDDEN]. False 22) (A = True / B = False) There are multiple ways in which linked genes can become unlinked. True 23) (A= True/B=False) Because males are XY a sex linked chromosome can only ever effect males. False 24) A phenotype is termed when it is “uncommon” in nature, or the result of a mutation. Mutant 25) Who determined the following: The number of adenines and the number of thymine’s is the same within a DNA sequence, and the number of guanines and the number of cytosine’s is the same. Erwin’s Chargaff’s rules 26) Which of the following pairs of DNA bases are the p[HIDDEN]? Purine-Adenine Guanine Pyrimidine- Thymine Cytosine 27) Which of the following is not a trait of DNA structure? Traits of DNA Nitrogenous base Ribose Sugar Phosphate Group Anti Parallel Double Helix Hydrogen bonds 28) [HIDDEN] makes hydrogen bonds with: Hydrogen bonds N-H H-O A-T G-C 29) Which of the following DNA sets would require the most energy to “melt” (i.e. for the chains to separate from each other). NOTE: you’re only seeing the content of 1 of the bases, think carefully! Set with the most Guanine and Cytosine or lowest amount of adenine 30) (A = True / B = False) DNA polymerase creates new [HIDDEN] and but is not capable of [HIDDEN] the strand as it is being made. False 31) What is the name of the process for creating [HIDDEN] from [HIDDEN]? RNA from DNA/ mRNA from Gene =Transcription 32) What is the name of the process for creating [HIDDEN] from [HIDDEN]? RNA to Protein/ mRNA to polypeptide = Translation 33) Using the rules of protein synthesis, and the following mRNA: 5’- AAUUAUGUAUGCCCUCUGAAU3’ what is the amino acid sequence produced? Met-Tyr-Ala-Leu-stop 34) (A = True / B = False) The genetic code is [HIDDEN] for each species. In general, the Genetic Code is universal 35) Which of the following distinguishes creation of RNA from the synthesis of DNA? During Transcription only 1 template strand is used to create RNA DNA synthesis uses 2 template strands RNA-Uracil DNA-Thymine DNA is self replicating RNA is synthesized from 1 DNA strand 36) What is the name of the site where RNA polymerase binds to begin synthesis of RNA? Promoter 37) If the RNA sequence is 5’-AUGUUUACG-3’ then what was the sequence of the non- template strand of the DNA? 5’-TACAAATGC-3’ 38) What is the carrier that brings amino acids to the ribosome? tRNA 39) Which of the following does not apply to a ribosome? The Ribosome Does THREE Things facilitates base pairing between a codon in mRNA and a tRNA’s anticodon catalyzes the dehydration reaction that joins amino acids covalently maintains the ‘frame’ of reading 40) What is the anticodon for [HIDDEN]? It's just the complementing bases! A complements U, G complements C. Ex AUG anticodon is UAC Show Less

Meer zien Lees minder
Instelling
Vak

Voorbeeld van de inhoud

Biology 1 Final Exam

Exam 1
1. When making a list about the primary elements of life, which of the following would not
be included?
- Hydrogen
- Oxygen
- Carbon
- Nitrogen
- Phosphorus
- Sulfur

2. From the options below, identify the list that has these functional groups: methyl,
phosphate, and hydroxyl. (Note the lists may not be in that order).
- Methyl Group: (1 Carbon Atom bonded to 3 Hydrogen Atoms)
- Phosphate Group: (1 Phosphorus Atom bonded to 4 Oxygen Atoms in a Tetrahedral
arrangement)
- Hydroxyl Group: (1 oxygen covalently bonded to 1 hydrogen)

3. Cell walls are composed of a material that is classified as a:
- Cellulose a polysaccharide

4. Estrogen is a steroid derived hormone, what type of biological material is used in the
creation of steroid hormones?
- Cholesterol (a Lipid)
5. Energy is vital to the cell and central to cellular processes, which type of biological
molecule can be used for the generation of energy?
- Carbohydrates
6. Microtubules, actin, and intermediate filaments are all found in cells. They are
responsible for a number of activities. Which of the following is not an activity
performed by those three materials?
- Microtubules: support, cell division (separation of chromosomes), cell/organelle
movement
- Actin: Forms microfilaments, cell movement, signaling, muscle contraction, cell
junctions
- Intermediate Filaments: support
7. All cells possess this structure that isolates them from the environment:
- Plasma membrane
- Phospholipid bilayer

,8. Considering all the properties that are used to define life, which of the following is not
one of the properties?
- Life is Isolated
- Has to be a barrier that separates it from its environment
- Life is Complex and Ordered
- Life is not at equilibrium
- Life at equilibrium is dead
- Life is regulated
- Life is responsive
- Life grows and reproduces
- Life is well adapted (this is subjective)
- Life requires and uses energy
- Life carries instructions DNA/RNA produces the instructions for things life needs for the
living thing to do all of the above

9. (A = True / B = False) The inherent difficulty of studying biology, is that each part of the
hierarchy from cells to ecosystems is entirely different in structure and themes.
- False

10. In examining the tree of life as it is theorized to have occurred from a common cellular
ancestor, we would see something interesting and that is:
- An early prokaryotic cell as the precursor to all cells

11. (A = True / B = False) The concept of evolution is still under debate in the scientific
community, this demonstrates that all topics in science are open for discussion!
- False

12. In 1953, Miller tested a hypothesis exploring the idea of the “primordial conditions” of
Earth. During this experiment in which he created a “sea” and an “atmosphere” he
electrified the atmosphere to simulate lightning as a result what was created?
- Organic molecules

13. On what hierarchical level of biology does evolution occur?
- Population

14. All of the elements of life first originated in
- Exploding stars

15. Which of the following statements about atoms is true?
- Definition of an atom

16. What is an ion?
- an atom or molecule with a net electric charge due to the loss or gain of one or more
electrons.

, 17. Most elements of life are more stable when they have how many electrons in their
outermost shell?
- 8 electrons in valence shell

18. In a covalent bond…
- Electrons are shared between atoms

19. Oxygen will form ____ covalent bonds and carbon will form ____ covalent bonds.
- Oxygen:2
- Carbon:4

20. (A = True / B = False) Water is a charged molecule.
- True

21. Hydrogen has essentially the same electronegativity as…
- Carbon

22. Which molecule, listed below, shows polar bonds?
-


23. (A = True / B = False) Ionic bonds are similar to electrostatic interactions, but they differ
in that electrostatic interactions are created by the transfer of electrons from one atom to
another.
- False

24. Which of the following would be the most stable?
-

25. How many atoms are in 2 moles of water molecules?
- (6.02 x 10^23) 6
- 36.14

26. (A = True / B = False) If a mole of Fluorine weighs approximately 19g, then the atomic
mass of fluorine is 19 daltons.
- true

27. 0.5 mol of sucrose in 0.5 L if water is equal to what molarity?
- 1

28. Acids release ____ that can be picked up by a(n) ____.
- Release protons
- Base

29. In neutral water the concentration of hydroxide is:
- 7

Geschreven voor

Instelling
Vak

Documentinformatie

Geüpload op
21 februari 2022
Aantal pagina's
24
Geschreven in
2021/2022
Type
Tentamen (uitwerkingen)
Bevat
Vragen en antwoorden

Onderwerpen

$14.49
Krijg toegang tot het volledige document:

Verkeerd document? Gratis ruilen Binnen 14 dagen na aankoop en voor het downloaden kun je een ander document kiezen. Je kunt het bedrag gewoon opnieuw besteden.
Geschreven door studenten die geslaagd zijn
Direct beschikbaar na je betaling
Online lezen of als PDF

Maak kennis met de verkoper

Seller avatar
De reputatie van een verkoper is gebaseerd op het aantal documenten dat iemand tegen betaling verkocht heeft en de beoordelingen die voor die items ontvangen zijn. Er zijn drie niveau’s te onderscheiden: brons, zilver en goud. Hoe beter de reputatie, hoe meer de kwaliteit van zijn of haar werk te vertrouwen is.
Rubricguru Chamberlain College Of Nursing
Volgen Je moet ingelogd zijn om studenten of vakken te kunnen volgen
Verkocht
1084
Lid sinds
6 jaar
Aantal volgers
1042
Documenten
3652
Laatst verkocht
6 maanden geleden
Rubric Guru

Nursing Being my main profession line, I have essential guides that are A graded, I am a very friendly person so don't hesitate to ask me for any assistant required to be well prepared. Thank you

3.5

138 beoordelingen

5
57
4
27
3
14
2
9
1
31

Recent door jou bekeken

Waarom studenten kiezen voor Stuvia

Gemaakt door medestudenten, geverifieerd door reviews

Kwaliteit die je kunt vertrouwen: geschreven door studenten die slaagden en beoordeeld door anderen die dit document gebruikten.

Niet tevreden? Kies een ander document

Geen zorgen! Je kunt voor hetzelfde geld direct een ander document kiezen dat beter past bij wat je zoekt.

Betaal zoals je wilt, start meteen met leren

Geen abonnement, geen verplichtingen. Betaal zoals je gewend bent via iDeal of creditcard en download je PDF-document meteen.

Student with book image

“Gekocht, gedownload en geslaagd. Zo makkelijk kan het dus zijn.”

Alisha Student

Bezig met je bronvermelding?

Maak nauwkeurige citaten in APA, MLA en Harvard met onze gratis bronnengenerator.

Bezig met je bronvermelding?

Veelgestelde vragen