BIO 235 - Final Exam 2022 quetions and answer All correct

BIO 235 - Final Exam Study Guide The Central Dogma of molecular biology states that, in cells, biological information _______. A. Can be transmitted either from DNA to RNA or from RNA to DNA B. Moves from DNA to RNA to protein C. Moves from protein to RNA to DNA D. Moves from DNA to RNA only if encoded by certain viruses E. Moves from protein to RNA only if encoded by certain viruses Ans: B What is the exception to the Central Dogma rule? Ans: RETROVIRUSES (process goes from RNA to DNA using reverse transcriptase enzymes) What do retroviruses have that allows them to go from RNA to DNA? Ans: Reverse transcriptase enzymes What category of transposable elements use an RNA copy of their genome in the process of transposition? A. Cut-and-paste transposons B. Composite bacterial transposons C. Bacterial insertion sequences D. Retrotransposons E. Multiple drug resistance plasmids Ans: D Copy-and-paste transposons a.k.a. replicative transposition Ans: A new copy of the transposable element is introduced at a new site while the old copy remains behind at the original site (so the number of copies of the transposable element increases) Transposons a.k.a. transposable elements Ans: Sequences that can move about in the genome and are often a cause of mutations Are direct repeats part of a transposon? Ans: NO Are inverted repeats part of a transposon? Ans: YES Transposition Ans: The movement of a transposon Cut-and-paste transposons a.k.a. nonreplicative transposition Ans: Transposable element excises from the old site and inserts at a new site WITHOUT any increase in the number of its copies Retrotransposons Ans: Elements that transpose through an RNA intermediate Mutagenic compounds that fit and "get stuck" between nucleotides of DNA molecules are called ________, whereas mutagenic compounds that cause the covalent attachment of a methyl or an ethyl group to bases of DNA are called ______. A. De-aminating agents; reactive oxygen molecules B. Oxidizing agents; glycosylases C. Intercalating agents; alkylating agents D. Hydrolases; base analogs E. Catalytic converters; organic solvents Ans: C Base analogs Ans: Chemicals with structures similar to that of any of the four standard bases of DNA (DNA polymerase canNOT distinguish these analogs from the standard bases) Alkylating agents Ans: Chemicals that donate alkyl groups like methyl and ethyl groups Deamination Ans: Removing an amino group Intercalating agents Ans: Produce mutations by sandwiching themselves (intercalating) between adjacent bases in DNA, distorting the three-dimensional structure of the helix and causing single-nucleotide insertions and deletions in replication What form of radiation causes double-strand breaks in DNA? Ans: X-rays (ionizing radiation) What form of radiation forms pyrimidine dimers (or thymine dimers)? Ans: UV rays Pyrimidine dimers Ans: Formation of a chemical bond between adjacent pyrimidine molecules on the same strand of DNA Depurination Ans: The loss of a purine base from a nucleotide How many amino acids are encoded in the following RNA sequence? 5' - AUGCCUGAAUGGGCUUUAUGA - 3' A. 3 B. 4 C. 5 D. 6 E. 7 Ans: D (there is no amino acid for a stop codon) What feature of the polypeptide chain determines the secondary structure of proteins? A. The last carboxyl group B. The first amino group C. Intra-molecular hydrogen bonding among amino acid units that induces the formation of alpha-helices and beta-pleated-sheets D. Interactions among the components of multi-protein complex E. The hinge regions that allow the alpha-helices and beta-pleated-sheets to fold in space Ans: C Primary structure of a protein Ans: Sequence of amino acids Secondary structure of a protein Ans: Interactions between neighboring amino acids causing a polypeptide chain to fold and twist (alpha helix and beta pleated sheet - regional folding) Tertiary structure of a protein Ans: Overall-three dimensional shape of the protein (when secondary structures fold even further) Quaternary structure Ans: When two or more polypeptide chains associate When codons that specify the same amino acid differ in ________, a single tRNA may be able to anneal to several of them through wobble base pairing. A. Any one of their nucleotides B. Any two or their nucleotides C. Their 5' nucleotide D. Their middle nucleotide E. Their 3' nucleotide Ans: E (wobble takes place on the THIRD position of a codon and the FIRST position of the anticodon) Where does wobble take place on the codon? (5' end or 3' end?) Ans: 3' end (third position) Where does wobble take place on the anticodon? (5' end or 3' end?) Ans: 5' end (first position) Through wobble, a single __________ can pair wit more than one __________. A. codon; anticodon B. group of three nucleotides in DNA; codon in mRNA C. tRNA; amino acid D. Anticodon; codon Ans: D The increase in number (expansion) of three-nucleotide repeats is responsible for? A. Sickle-cell anemia B. Xeroderma pigmentosum C. Alkaptonuria D. Trisomy 21 E. Fragile X syndrome F. None of the above Ans: E How many copies of the CGG repeat does a normal/unaffected person? (fragile X syndrome) Ans: Less than 55 (60) How many copies of the CGG repeat does a premutated individual have? (fragile X syndrome) Ans: 55-230 How many copies of the CGG repeat does an affected individual have? (fragile X syndrome) Ans: more than 230 Are somatic mutations inherited? Ans: NO (produce patches - basis for cancers) Are germ-line mutations inherited? Ans: YES Intragenic suppressor mutation Ans: Takes place in the same gene as that containing the mutation being suppressed (may change a second nucleotide in th