Department of Life and Consumer Sciences Molecular Genetics

Question 1 [15] Describe and illustrate how you could differentiate between these four DNA strands, using DNA melting experiments: Strand 1: 5ʹATTTTAAATTAGCATTTAAT3ʹ Strand 2: 5ʹATGCCGATATTTTTAGCGCA3ʹ Strand 3: 5ʹAGCGGGGCGGCAGCGCGGAT3ʹ Strand 4: 5ʹAGCGGGGCGGCAGCGCGGATA3ʹ Question 2 [10] Your friend studying computer science is designing a new protein folding tool that will predict protein folding pathways. Explain to them, using your UNISA BCH3703 module content, why a particular protein folds very rapidly in the presence of protein disulphide isomerase but aggregates and never folds correctly without protein disulphide isomerase. Also, the folding of the protein is very slow without peptidyl prolyl cis-trans isomerase enzymes. Question 3 [15] Describe two methods, discussed in BCH3703, that a researcher could employ to determine if a gene is wrapped around a histone octamer or not. Question 4 [15] Your same friend studying computer science needs you to describe the general structural features of transcription factors and how these features relate to function for the design of a building block tool “create any transcription factor possible”. Supply the information in a summary of less than 400 words with only details from BCH3703. BCH3703 Assignment 2 Semester 1 2022 4 This study source was downloaded by from CourseH on :06:36 GMT -05:00 Question 5 [15] Compare and contrast eukaryotic RNA polymerases. Your answer must be in the format of the table below RNA Polymerase Promoter location elements and Types of synthesised RNA Question 6 [10] Explain how the following would impact DNA replication in prokaryotes and eukaryotes. 6.1 The absence of UTP. (5) 6.2 Mutation in the origin of replication sequence. (5) Question 7 [20] You have been tasked by a new pharmaceutical company to explain how you will produce stick protein. Stick protein is found in a new pathogenic plant, humans that touch this plant become ill and immunising them against stick protein will prevent illness. The pharmaceutical company wants you to explain how to produce pure stick protein in a bacterial system if all you are given is some of the pathogenic plant cells and you know the sequence of the stick gene.