PURIFICATION OF HEXAHISTIDINE TAGGED GFP PROTEIN FROM TRANSFORMED E.COLI XL1 CELLS USING IMMOBILIZED METAL AFFINITY CHROMATOGRAPHY

PURIFICATION OF HEXAHISTIDINE TAGGED GFP PROTEIN FROM TRANSFORMED
E.COLI XL1 CELLS USING IMMOBILIZED METAL AFFINITY CHROMATOGRAPHY
Lee Jia Yi

18803707 (12)


Abstract after purification. By incorporating restriction
enzyme sites into primers, the product will
In this study, a recombinant histidine-tagged contain the restriction enzyme site, allowing it to
green fluorescence protein(His6-GFP) was be easily inserted into a vector by restriction
produced by E.coli XL1 cells followed by digestion and ligation. To create the protein, the
immobilized metal affinity chromatography recombinant vector must first be transformed into
(IMAC) using Nickel-agarose beads for cells and produced according to the vector
purification. The GFP template was first construct. Thus, a vector containing a selection
amplified from pE-GFP vector using marker, a highly regulated promoter, multiple
polymerase chain reaction (PCR). The primers restriction enzyme sites and a polylinker sequence
contained restriction enzyme sites were at either end of the target gene is recommended.
designed specifically to target GFP opening (Hengen, 1995)
reading frame in pE-GFP. Insertion was done
by digesting amplified GFP template and Transformation is challenging because it is hard
pQE30 vector with BamHI and HindIII, to attain cells with high transformation efficiency.
followed by ligation. Recombinant vector was To ensure a successful transformation, cells must
transformed into E.coli XL 1 cells using Inoue be capable to take up the recombinant vector, or
et al. method and cells were grown on the protein of interest cannot be produced.
ampicillin LB agar for selection purposes. Cells According to Inoue, et al., performing
that glowed under UV lamp were selected and transformation in an ice bath for 30 minutes
induced for 2 hours with IPTG to produce followed by 40 seconds of heat shock can greatly
His6-GFP. His6-GFP was then purified using improve the transformation efficacy. Researchers
IMAC and the purity of His6-GFP was have thus been using the Inoue, et al. method for
quantified by Bradford and fluorescence assay. transformation. After transformation, desired
Results showed that the purity of His6-GFP is proteins can be purified from the cells. As
1.58 times better than crude extracts. Also, a mentioned earlier, the tagged proteins aid in
27 kDa band appeared on the western blot, protein purification due to the nature of histidine.
signifying that adding histidine tags to the Histidine has a high affinity for nickel and copper,
protein makes purification easier and more thus IMAC can be used for purifying of histidine
specific. Protein production using this method tagged proteins. Nickel, which serves as a ligand,
greatly benefited pharmaceutical companies in will bind to the histidine-tagged protein (Hage,
mass production of vaccines and researchers to 1999) such that it can be separated easily from
study the protein structure. (Hengen, 1995) other proteins in the cell with up to 95% purity.
(Hengen 1995) (Ha et al., 2008)

INTRODUCTION Thus, in this experiment, GFP template was
introduced into the pQE30 vector before
Polymerase chain reaction (PCR) is commonly undergoing transformation into E.coli XL-1 cells
used to amplify the gene of interest. (Hayashi, using Inoue et al. method. The purpose of this
1994) The final PCR product is dependent on the study is to create a hexahistidine-tagged Green
primer sequence. (Mullis and Faloona 1987) Fluorescence Protein (GFP) and assess the purity
Thus, primers are designed to target specific of proteins upon using IMAC by Bradford and
genes which make PCR a diagnostic tool fluorescence assay. Results have shown that
commonly used for clinical applications and purity of GFP protein is 1.58 times better than cell
screening of genetic diseases. (Rossiter and extracts after performing IMAC.
Caskey, 1994) Additionally, many researchers
adopted this procedure for cloning to produce
histidine-tagged fusion protein for protein study EXPERIMENTAL PROCEDURES

1

, 100 μl E.coli XL-1 blue competent cells
(Genomax Technologies, SG) with 1.7 μl of 2-
Amplification of GFP opening reading frame Mercaptoethanol were incubated on ice in Tube A
(ORF) from vector pE-GFP by using PCR to E for 10 minutes with shaking. Then, 2 μl
GRP ORF was amplified from 50 ng/μl of pE- ligated samples from Tube 1 to 3 and 2 ng/μl of
GFP template in 50 μl reaction including 500nM uncut pQE-GFP and sterile H2O were added into
forward primer containing BamHI site (E1;5’- Tube A to E respectively, Next, cells were
GCGCAGGGATCCGTGAGCAAGGGCGAG- incubated on ice for 30 minutes followed by 42°C
3’) and reverse primer containing HindIII site incubation for 45 seconds. (Inoue, et al., 1990)
(E2;5’CAGGCGAAGCTTTTACTTGTACAGCT After cooling, 0.9ml pre-warmed SOC media was
CGTC-3’) (Integrated DNA technologies, added to Tube A to E. Cells were plated on LB
Coralville, US), 2.5mM dNTPs (Promega, agar with 100 μg/ml ampicillin (Axil Scientific,
Madison, US), 1.5U Vent polymerase, 10x Vent SG) and 0.1mM IPTG (Axil Scientific, SG) after
Buffer (New England Biolabs, Ipswich, US), and 1-hour incubation at 37°C.
sterile water. For an adequate reaction, 30 cycles
were performed to yield a PCR product of about Checking the integrity of transformation by
850 bp with BamHI and HindIII recognition sites. restriction enzyme digestion and induction of
Denaturation was done at 94°C for 2 minutes then the synthesis of His6-GFP in transformed cells
each cycle consists of 94°C for 50 seconds, 50°C Two colonies with and without GFP insert were
for 50 seconds, 72°C for 1.20minutes followed by selected using UV lamp and inoculated into 4
extension at 72°C for 3 minutes. (Mullis, et al., tubes of 10 ml terrific broth with 100 μg/ml
1994) After PCR, 3 μl PCR product was diluted in ampicillin. Then, cells were incubated overnight
2 μl 6x loading dye and 5 μl sterile H2O. The at 37°C with shaking. Next day, 1.5ml aliquots
sample electrophoreses through 0.8% SYBR-safe from each culture were purified using DNA
stained agarose gel at 100 volts for 30 minutes Plasmid Mini-Prep kit (Promega, Madison, US)
and viewed under Gel Chemidoc (Bio-Rad, and restriction digestion was performed. 10 μl of
Hercules, US). The remaining PCR product was purified samples were digested for 2 hours at
purified according to QIAQUICK PCR 37°C using 1 μl of BamHI and HindIII in 2μl 10x
Purification Kit (Qiagen, Hilden, DE). Buffer E (New England Biolabs, Ipswich, US).
Digested samples electrophorese through 0.8%
Restriction digestion on amplified GFP ORF SYBR-safe stained agarose gel and result is
and pQE30 vector shown in Figure 2.
18 μl of GFP DNA in Tube 1 and pQE30 DNA in
Tube 2 were digested for 2 hours at 37°C with 5 The remaining +GFP culture with an OD600 of
μl of BamHI/HindIII premix and 2 μl of 10x 0.2 was incubated at 37°C for 1 hour with
Buffer E (New England Biolabs, Ipswich, US). shaking. After yielding an OD600 of 0.6, the
After completion, 30 μl of digested DNA with culture was incubated at 37°C for another hour
loading buffer electrophoreses through the with shaking after adding 1mM of IPTG. Then,
NuSieve gel (Lonza, Basel, CH) for 1 hour at 80 OD600 reading was recorded and subjected to
volts. Expected bands were cut and purified using another hour of incubation. Similarly, OD600
Gel purification kit (Promega, Madison, US). reading was obtained after incubation. 1ml
aliquots were also pelleted after every incubation
Transformation of recombinant pQE30 vector and labeled according to the incubation time, “0”,
into competent E. coli cells “+1” and “+2”. The remaining culture was
3 ligations were performed; Tube 1 contained centrifuged at 2504 x g for 15 minutes and cells
both GFP and pQE30 DNA while Tube 2 and 3 were pelleted in a 50ml tube.
contained GFP DNA and pQE30 DNA
respectively. Firstly, 5 μl of digested DNA in Immobilized metal affinity chromatography
Tube 2 and 3 were ligated for 2 hours at room (IMAC)
temperature (r.t.p) in 15.5 μl reaction of 0.5U T4 Purifications of His6-GFP is purified using
DNA ligase in 10x ligation buffer (Promega, IMAC. (Hage, 1999) The cell pellet in 50ml tube
Madison, US) and water except for Tube 1, 10μl was reconstituted in 5 ml of lysis buffer (50mM
of digested DNA was ligated. After ligation, NaH2PO4 pH 8, 300mM NaCl2, 0.2mg/ml
samples were used in the transformation process. lysozyme) by gentle pipetting and incubated for
20 minutes at 37°C with occasional mixing. Then,


2