1. The goal of this integrated practical course is to purify a protein. In general, what is
the value of protein purification to medical research? What information can a
purified protein provide and what techniques can be developed/employed once you
have a purified protein?
In vitro studies - Small molecule interactions, protein binding partners etc
Producing antibodies
Determination of structure
Purification of the protein is a valuable step in medical research to better comprehend how
the biological systems work. For instance, specific polypeptide growth factor like VEGF
protein is isolated in vivo to study how an organism regulates process like angiogenesis.
By isolating and purifying the protein of interest, its enzymology such as function, structure
and signalling capability can be studied in detail. Purified protein can also act as a valuable
chemical reagent to obtain proteases, DNA polymerases, reverse transcriptase, and ligases
etc.
Protein purification can be either preparative or analytical. Gel electrophoresis technique is
used commonly for both by denaturing the protein with detergents like SDS and separate
them based on their sizes. Additional tests like mass spectrometry, western blot and ELISA
can be used to detect and quantify the amount of desired protein.
2. From where does green fluorescent protein (GFP) originate? How has it been
modified for use in the laboratory?
GFP originates from jellyfish Aequorea Victoria.
wtGFP has broad excitation peaks, which means they absorb multiple colours of
light.
Makes it unsuitable for FRET (can explain abit of FRET)
WTGFP is slow in the formation of the chromophore, taking over 2 hours for the final
oxidation to occur.
wtGFP also tends to form dimers and trimers, increasing the molecule in weight
massively.
Can inhibit not only the function of proteins they are attached to but also the
function of the GFP itself. The increased size of the dimerised and trimerized GFP
molecules can inhibit the movement of tagged proteins around the cell and through
membranes.
Therefore…. the easiest way to solve these problems is to engineer colonies of bacteria to
express the gene and allow them to grow, letting nature produce mutant variants of GFP in
,time. In the experiment undertaken by Roger Tsien, a large proportion of these mutations
destroyed the fluorescence, but a small fraction resulted in improvements. These included
variants that shifted the excitation and emission peaks, changing the colors, variants that
replace the two excitation peaks by one, increasing the brightness, and ones that oxidise
much faster. As well as GFP mutations, mutations in a similar protein found in a type of
coral, Discosoma, called RFP as it fluoresces red, have resulted in a wide spectrum of usable
fluorescent proteins.
3. What are the characteristics of GFP that make it useful for in vivo studies?
Fluorescence
Non-toxic
Does not require additional cofactors or substrates to fluoresce
GFP is stable, specific, easy to use, non-toxic and does not interfere with cell growth
and its function.
Does not interfere (usually) with localization/function of other proteins
4. Below is the forward primer sequence to be used for amplifying the GFP open
reading frame:
Primer #1 (forward) 5’ gcgcagggatccgtgagcaagggcgaggag 3’
pE-GFP non-coding strand 3’
ctaggtggccagcggtggtacactcgttcccgctcctcgacaagtggccccaccacggg 5’
**Triplet codon highlighted in turquoise initiates Methionine
Identify which areas will anneal to the GFP sequence. What is the function of the
other (non-annealing) parts of the primer?
BamHI restriction site GATCC will anneal to the GFP sequence. The primer will anneal
to the GFP sequence after “gatcc”. The non-annealing parts are the known as the
sticky ends. The sticky ends serves as a guide to insert the amplified GFP sequence
into the desired vector.They may also bind to each other to form blunt ends.
5. Regarding restriction digestion, what is meant by “sticky ends” and “blunt ends”. In
molecular cloning when is it desirable to have one or the other?
, Sticky ends can anneal to each other’s compatible ends and become ligated in a
sticky end ligation. Blunt end may be ligated to another blunt end. Blunt ends may
be generated by RE such as Smal and EcoRV.
Major advantage of blunt end cloning is that the desired insert does not
require any restriction sites in its sequence as blunt-ends are usually
generated in a PCR, and the PCR generated blunt-ended DNA fragment may
then be ligated into a blunt-ended vector generated from restriction digest.
1. Ligation is much less efficient than sticky end ligation, typically the reaction is 100X
slower than sticky-end ligation
2. The concentration of ligase used is higher than sticky end ligation (10x or more)
3. The conc. of DNA used in blunt-end ligation is also higher to increase the likelihood
of collisions between ends.
4. Longer incubation time may also be used for blunt end ligations
Blunt ends:
Sticky ends:
, 6. What is a type II restriction enzyme? What is meant by a 6-base cutter restriction
enzyme? For molecular cloning why would this be preferable to a 4-base cutter? In
a random DNA sequence what is the frequency of a 6-base cutter restriction site?
Type II restriction enzymes cleaves DNA at specific restriction sites close to or within
their recognition sequences producing small, well defined DNA fragments
6-base cutter restriction enzymes cleave DNA at recognition sites that are 6bp long.
6-base cutters cut DNA less frequently than 4-base cutters. Less likely to cut gene of
interest.
6-base cutters will cut at an estimated frequency of 1 every 4096 bp.
o 4 types of bases (ACTG), restriction site 6 bp long
o (¼)6 = 1/4096
The frequency by which a Class II RE will cut DNA is mainly a function of the length of
the sequence it is sensitive to. For instance:
- BsuRI has a recognition sequence of 4 bp. Out of sheer probability, we see that with
4 positions, and each position having potentially 4 different values, there are 44 =
256 different possibilities for any given 4-base long strand. Therefore, theoretically
(assuming completely random DNA), this enzyme will cut 1 in 256 4bp long sites.
- EcoRI recognizes a sequence of 6 bp. 46 = 4096 possible combinations with this
length, and so EcoRI will cut 1 in 4096 6bp long sites.
- NotI has a recognition sequence of 8 bp. 48 = 65536 possible combinations, and so
NotI will theoretically cut one out of 65536 8bp long sites.
Topic 2 PCR amplification of the GFP open reading frame
1. From where does Vent polymerase originate? Why are we using Vent polymerase
rather than Taq polymerase for amplifying the GFP open reading frame?
Vent polymerase was originated and isolated from a thermophilic bacteria called
Thermococcus Litoralis found in the deep sea hydrothermal vents, shallow
submarine thermal springs and oil wells.