www.ncrtsolutions.in
NCERT Solutions for Class 12 Biology Chapter 6
Molecular Basis of Inheritance Class 12
Chapter 6 Molecular Basis of Inheritance Exercise Solutions
Exercise : Solutions of Questions on Page Number : 125
Q1 :
Group the following as nitrogenous bases and nucleosides:
Adenine, Cytidine, Thymine, Guanosine, Uracil and Cytosine.
Answer :
Nitrogenous bases present in the list are adenine, thymine, uracil, and cytosine.
Nucleosides present in the list are cytidine and guanosine.
Q2 :
If a double stranded DNA has 20 per cent of cytosine, calculate the per cent of adenine in the DNA.
Answer :
According to Chargaff's rule, the DNA molecule should have an equal ratio of pyrimidine (cytosine and thymine) and
purine (adenine and guanine). It means that the number of adenine molecules is equal to thymine molecules and the
number of guanine molecules is equal to cytosine molecules.
% A = % T and % G = % C
If dsDNA has 20% of cytosine, then according to the law, it would have 20% of guanine.
Thus, percentage of G + C content = 40%
The remaining 60% represents both A + T molecule. Since adenine and guanine are always present in equal
numbers, the percentage of adenine molecule is 30%.
Q3 :
If the sequence of one strand of DNA is written as follows:
5'-ATGCATGCATGCATGCATGCATGCATGC-3'
Write down the sequence of complementary strand in 5' → 3' direction
Answer :
www.ncrtsolutions.in
, www.ncrtsolutions.in
The DNA strands are complementary to each other with respect to base sequence. Hence, if the sequence of one
strand of DNA is
5'- ATGCATGCATGCATGCATGCATGCATGC - 3'
Then, the sequence of complementary strand in direction will be
3'- TACGTACGTACGTACGTACGTACGTACG - 5'
Therefore, the sequence of nucleotides on DNA polypeptide in direction is
5'- GCATGCATGCATGCATGCATGCATGCAT - 3'
Q4 :
If the sequence of the coding strand in a transcription unit is written as follows:
5'-ATGCATGCATGCATGCATGCATGCATGC-3'
Write down the sequence of mRNA.
Answer :
If the coding strand in a transcription unit is
5'- ATGCATGCATGCATGCATGCATGCATGC-3'
Then, the template strand in 3' to 5' direction would be
3' - TACGTACGTACGTACGTACGTACGTACG-5'
It is known that the sequence of mRNA is same as the coding strand of DNA.
However, in RNA, thymine is replaced by uracil.
Hence, the sequence of mRNA will be
5' - AUGCAUGCAUGCAUGCAUGCAUGCAUGC-3'
Q5 :
Which property of DNA double helix led Watson and Crick to hypothesise semi-conservative mode of DNA
replication? Explain.
Answer :
Watson and Crick observed that the two strands of DNA are anti-parallel and complementary to each other with
respect to their base sequences. This type of arrangement in DNA molecule led to the hypothesis that DNA
replication is semi-conservative. It means that the double stranded DNA molecule separates and then, each of the
separated strand acts as a template for the synthesis of a new complementary strand. As a result, each DNA
molecule would have one parental strand and a newly synthesized daughter strand.
Since only one parental strand is conserved in each daughter molecule, it is known as semi-conservative mode of
replication.
www.ncrtsolutions.in
NCERT Solutions for Class 12 Biology Chapter 6
Molecular Basis of Inheritance Class 12
Chapter 6 Molecular Basis of Inheritance Exercise Solutions
Exercise : Solutions of Questions on Page Number : 125
Q1 :
Group the following as nitrogenous bases and nucleosides:
Adenine, Cytidine, Thymine, Guanosine, Uracil and Cytosine.
Answer :
Nitrogenous bases present in the list are adenine, thymine, uracil, and cytosine.
Nucleosides present in the list are cytidine and guanosine.
Q2 :
If a double stranded DNA has 20 per cent of cytosine, calculate the per cent of adenine in the DNA.
Answer :
According to Chargaff's rule, the DNA molecule should have an equal ratio of pyrimidine (cytosine and thymine) and
purine (adenine and guanine). It means that the number of adenine molecules is equal to thymine molecules and the
number of guanine molecules is equal to cytosine molecules.
% A = % T and % G = % C
If dsDNA has 20% of cytosine, then according to the law, it would have 20% of guanine.
Thus, percentage of G + C content = 40%
The remaining 60% represents both A + T molecule. Since adenine and guanine are always present in equal
numbers, the percentage of adenine molecule is 30%.
Q3 :
If the sequence of one strand of DNA is written as follows:
5'-ATGCATGCATGCATGCATGCATGCATGC-3'
Write down the sequence of complementary strand in 5' → 3' direction
Answer :
www.ncrtsolutions.in
, www.ncrtsolutions.in
The DNA strands are complementary to each other with respect to base sequence. Hence, if the sequence of one
strand of DNA is
5'- ATGCATGCATGCATGCATGCATGCATGC - 3'
Then, the sequence of complementary strand in direction will be
3'- TACGTACGTACGTACGTACGTACGTACG - 5'
Therefore, the sequence of nucleotides on DNA polypeptide in direction is
5'- GCATGCATGCATGCATGCATGCATGCAT - 3'
Q4 :
If the sequence of the coding strand in a transcription unit is written as follows:
5'-ATGCATGCATGCATGCATGCATGCATGC-3'
Write down the sequence of mRNA.
Answer :
If the coding strand in a transcription unit is
5'- ATGCATGCATGCATGCATGCATGCATGC-3'
Then, the template strand in 3' to 5' direction would be
3' - TACGTACGTACGTACGTACGTACGTACG-5'
It is known that the sequence of mRNA is same as the coding strand of DNA.
However, in RNA, thymine is replaced by uracil.
Hence, the sequence of mRNA will be
5' - AUGCAUGCAUGCAUGCAUGCAUGCAUGC-3'
Q5 :
Which property of DNA double helix led Watson and Crick to hypothesise semi-conservative mode of DNA
replication? Explain.
Answer :
Watson and Crick observed that the two strands of DNA are anti-parallel and complementary to each other with
respect to their base sequences. This type of arrangement in DNA molecule led to the hypothesis that DNA
replication is semi-conservative. It means that the double stranded DNA molecule separates and then, each of the
separated strand acts as a template for the synthesis of a new complementary strand. As a result, each DNA
molecule would have one parental strand and a newly synthesized daughter strand.
Since only one parental strand is conserved in each daughter molecule, it is known as semi-conservative mode of
replication.
www.ncrtsolutions.in
