. You have sequenced a gene and observe the following:
Reference: atgctggcacgacaggtttcccgactgg
Sequenced: atgCTGctggcacgacaggtttcccgactgg
The mutation observed is a:
a. Frame-shift mutation
b. Insertion
c. Silent mutation
d. Non-conservative mutation - ✔Insertion
3 cerebrospinal fluid (CSF) tubes labeled 1 through 3 have arrived in your clinical
laboratory for evaluation. The tubes were numbered in the order in which they were
obtained, with #1 being the first tube collected and #3 being the last tube collected.
What is the best explanation for a macroscopic appearance seen in the CSF?
a. A traumatic tap
b. A normal CSF collection
c. A subarachnoid hemorrhage
d. Presence of immature white blood cells - ✔A traumatic tap
A cerebrospinal fluid (CSF) sample for hematologic evaluation should be tested within
how many hours of collection?
a. 1 hour
b. 2 hours
c. 3 hours
d. 4 hours - ✔1 hour
A DNA specimen was sent to your Molecular Diagnostics Laboratory for DNA
sequencing, in order to determine whether patient A has a particular mutation in gene X.
The gene sequence is known. However, the gene mutation itself is not known.
Therefore, DNA sequencing cannot be performed on this DNA specimen. (True or
False)
a. True
b. False - ✔True
You can't find something you don't know the sequence of.
A parent has an autosomal dominant disorder. What percent chance does this parent
have to pass down this affected gene to his/her child?
a. 0%
b. 25%
,MB ASCP CONNECT 2023-20224 EXAM A+ GRADED
c. 50%
d. 75%
e. 100% - ✔50%
A parent has an autosomal recessive disorder. What percent chance does this parent
have to pass down this affected gene to his/her child?
a. 0%
b. 25%
c. 50%
d. 75%
e. 100% - ✔100%
A patient with impaired judgment, personality changes, signs of abnormal body
movements and depression comes to the physician's office for a follow-up visit. The
physician suspects a single-gene disorder may be the cause of those clinical
manifestations. A blood specimen was then sent to your clinical laboratory for mutation
screening in the Huntingtin gene. Testing with standard PCR indicates that patient has
Huntington Disease, HD. Which of the following would be consistent with this
diagnosis?
a. 25 CAG repeats in the Huntingtin gene
b. 85 CAG repeats in the Huntingtin gene
c. 25 CGA repeats in the Huntingtin gene
d. 85 CGA repeats in the Huntingtin gene - ✔85 CAG repeats in the Huntingtin gene
TIP: "Huntington" beach in CA usually 85 deg.
A patient with impaired judgment, personality changes, signs of abnormal body
movements and depression comes to the physician's office for a follow-up visit. The
physician suspects a single-gene disorder may be the cause of those clinical
manifestations. A blood specimen was then sent to your clinical laboratory for mutation
screening in the Huntingtin gene. Which of these methods would best accomplish this
task?
a. Methylation-specific PCR
b. Standard PCR
c. PFGE
d. RAPD PCR - ✔Standard PCR
A reverse dot blot is best performed by:
a. Immobilizing multiple unlabeled probes onto the membrane and then allowing one
labeled sample to hybridize to the unlabeled probes
b. Immobilizing one labeled probe onto the membrane and allowing multiple labeled
samples to hybridize to the labeled probe
,MB ASCP CONNECT 2023-20224 EXAM A+ GRADED
c. Immobilizing multiple unlabeled probes onto the membrane and allowing multiple
unlabeled samples to hybridize to the unlabeled probes
d. Allowing a single labeled sample to hybridize to multiple labeled single stranded
probes onto the membrane - ✔Immobilizing multiple unlabeled probes onto the
membrane and then allowing one labeled sample to hybridize to the unlabeled probes
A technologist uses the spectrophotometer to quantify the amount of DNA extracted
from a blood specimen diluted 1:30. The absorbance reading at 260 nm was found to
be 2.545. If the absorbance at 280 nm gave a reading of 1.406, and if the the DNA
extract was re-suspended in 0.800 mL of EDTA solution, the DNA yield is:
a. 3540 micrograms
b. 3450 micrograms
c. 3504 micrograms
d. 3054 micrograms - ✔3054 ug
260 reading x 50 ug/ml (DNA) x dilution factor x resupsension = DNA Yield
260 x 50 x 30 x 0.8 = 3054
A technologist uses the spectrophotometer to quantify the amount of DNA extracted
from a blood specimen diluted 1:30. The absorbance reading at 260 nm was found to
be 2.545. The concentration of DNA in this extract is:
a. 76.35 micrograms/mL
b. 3817.5 micrograms/mL
c. 381.75 micrograms/mL
d. 3054.0 micrograms/mL - ✔3817.5 ug/ml
260 nm x 50 ng/ul (DNA) x 30 (dilution factor) = conc. DNA
According to Chargaff's rule of base pairing, adenine pairs with:
a. Cytosine
b. Threonine
c. Thymine
d. Thymidine - ✔Tymine
According to the wobble hypothesis, a U in the 5' position of the anit-codon can pair
with:
a. U or C
b. A or G
c. A, C or G
d. Only A - ✔A or G
, MB ASCP CONNECT 2023-20224 EXAM A+ GRADED
U replaces T, and binds to A. Wobble is something other than A
Acute promyelocytic leukemia (APL) is responsible for what translocation?
a. t(8;14)
b. t(15;17)
c. t(9;22)
d. t(11;22) - ✔t(15;17)
After a patient received a bone marrow transplant, what virus is the patient more
susceptible to?
a. HCV
b. CMV
c. HIV
d. HPV - ✔CMV
After an amplification procedure followed by gel electrophoresis, you took a photo of
your gel. You notice consistent bands in all your gel lanes. However, you also see what
appears to be a faint but noticeable band in your reagent blank lane. What is your best
explanation for the reagent blank band?
a. Taq polymerase concentration was too low in this PCR reaction
b. There was obvious contamination in this PCR reaction
c. The primers concentration was too high in this PCR reaction
d. The dNTPs concentration was too high in this PCR reaction. - ✔There was obvious
contamination in this PCR reaction
All of the following are components of nucleic acids, EXCEPT:
a. Phosphate group
b. Sugar (ribose or deoxyribose)
c. Nitrogenous base (A, G, C, T)
d. Formamide - ✔Formamide
All of the following are liquid tumors, except:
a. Mantle cell lymphoma
b. Ewing sarcoma
c. Burkitt's lymphoma
d. Acute promyelocytic leukemia - ✔Ewing sarcoma
Bone
All of the following are trinucleotide repeat disorders, EXCEPT: