EXAM 200 QUESTIONS AND CORRECT ANSWERS
What genes would be screened in a lung cancer panel? - ✔KRAS, EGFR, ALK
In a retrovirus, the RNA acts as: - ✔Genome and mRNA
To what does the AcrAB gene product create resistance to? - ✔Tetracycline
What gene is measured following the treatment with imatinib(Gleevec)? - ✔BCR/Abl
Blood drawn into what type of tube is compatible for genetic testing? - ✔K2-EDTA tube
Primer dimers are due to what complimentary issue? - ✔3' to 3' complementarity of
primer pairs
Microsatellite instability is best described as: - ✔Contraction or expansion of the
genomes caused by frameshift mutations (deletions or insertions) in elements of the
genome consisting of a repeating sequence of 1-3 base pairs
How many hydrogen bonds are formed between one C:G base pair? - ✔3
When this enzyme finds nicks or gaps in the sugar-phosphate backbone of DNA, it
closes them - ✔Ligase
What assay amplifies the target using DNA ligase? - ✔LCR
What genes would be screened in a breast cancer panel? - ✔HER2, ERBB2, BRCA1
What factors can affect nucleic acid hybridization? - ✔G:C ratio of bases
pH of the hybridization reaction
Hybridization temperature
Both parents are carriers of an autosomal recessive disorder. What percent chance do
these parents combined have to pass down this affected gene to their child? - ✔75%
Consider the probe sequence, CTACCGTAATATTCGACCGT, to be used in a
hybridization procedure. What is the melting temperature, Tm, of the sequence? - ✔
58*C
The enzyme that primes DNA synthesis is: - ✔DNA primase
Splicing is the process that: - ✔Removes introns and preserves exons
,MB ASCP CONNECT EXAM LATEST 2023-2024 ACTUAL
EXAM 200 QUESTIONS AND CORRECT ANSWERS
All of the following enzymes are part of the DNA replication machinery - ✔Ligase, DNA
polymerase, Helicase
This translocation creates a fusion protein between the Abl1 gene on one chromosome
and the BCR gene on the other chromosome, resulting in chronic myelogenous
leukemia (CML): - ✔t(9;22)
Given the anti-sense strand of DNA: 5'-AATTGCCGACATAGAT-3' which is the
appropriate sense strand? - ✔5'-ATCTATGTCGGCAATT-3'
All of the following methods of amplification are considered target amplification: - ✔
Quantitative PCR
Strand Displacement Amplification
Reverse Transcriptase PCR
What stain binds to minor groove of DNA Duplex? - ✔SYBR1
The purines are: - ✔Adenine and guanine
Purines and pyrimidines differ from each other in that: - ✔Purines have two rings;
pyrimidines have one ring
What gene is measured following treatment with Warfarin? - ✔VKORC1
According to Chargaff's rule of base pairing, adenine pairs with: - ✔Thymine
When comparing 2 samples in a qPCR Amplification plot, a log difference can be seen
as approximately: - ✔ΔCt = 3.3
The process of making RNA is termed: - ✔Transcription
When sequencing HLA-DR what is targeted? - ✔Exon 2 of the β subunit
All of the following are components of nucleic acids: - ✔Phosphate group
Sugar (ribose or deoxyribose)
Nitrogenous base (A,C,G,T)
Branched DNA amplification (bDNA) is best classified as: - ✔Signal amplification
This PCR method works by generating a signal at the annealing step (i.e. when the
probe binds its target) of the PCR reaction: - ✔Molecular beacons
,MB ASCP CONNECT EXAM LATEST 2023-2024 ACTUAL
EXAM 200 QUESTIONS AND CORRECT ANSWERS
What is the predominant form of DNA? - ✔B form
Mantle cell lymphoma (MCL) is caused by what translocation? - ✔t(11;14)
What responds poorly to Ribavarin/Interferon treatment? - ✔HCV type 1 & 4
The sugar in DNA is: - ✔Deoxyribose
Why is it critical to maintain workflow from "clean" to "dirty" while working in a molecular
lab? - ✔To avoid contamination of specimens with amplified product which create false
positive results
Which two HPV types are responsible for most cases of cervical cancer? - ✔16 and 18
The amelogenin locus, found on the sex chromosomes, is used in gender identification.
Amplification at this locus reveals 2 peaks of sizes 212 and 218 base pairs. If this
amplification were part of a gender identification procedure, what would be the gender
of the individual? - ✔Male
This restriction enzyme "digests and removes a methyl group from Adenine": - ✔Type I
To what does the mecA gene product create resistance to? - ✔Penicillin
3 cerebrospinal fluid (CSF) tubes labeled 1 through 3 have arrived in your clinical
laboratory for evaluation. The tubes were numbered in the order in which they were
obtained, with #1 being the first tube collected and #3 being the last tube collected.
What is the best explanation for a macroscopic appearance seen in the CSF? - ✔A
traumatic tap
Next Generation Sequencing set-up require: - ✔Library preparation and extensive
bioinformatics analysis
The nitrogenous base in a nucleotide is expected to be found on which position of the
sugar? - ✔C1'
In which of the following methods is the probe digested by the polymerase (Taq) during
primer extension? - ✔Taqman
This polymerase is involved in "initiation of DNA replication and has primase activity": -
✔Pol α
What is the sequence recognized by poly (A) polymerase? - ✔AAUAAA
, MB ASCP CONNECT EXAM LATEST 2023-2024 ACTUAL
EXAM 200 QUESTIONS AND CORRECT ANSWERS
In the field of molecular diagnostics, which one of the following genes is responsible for
the synthesis of DNA, promote cell division, and inhibit cell death? - ✔Proto-oncogenes
How is warfarin dosage affected in patients with VKORC1 deficiency? - ✔Patients
receive a lower warfarin dose
This polymerase is involved in "short-patch base excision repair": - ✔Pol β
What is the best way to store RNA for longer than a month? - ✔In Ethanol, at -20°C or -
80°C
The rate of DNA migration through an agarose gel during electrophoresis does depend
on which factors? - ✔Net charge of the molecule
Size of the molecule
Shape of the molecule
What assay amplifies the target using a combination of a three-enzyme system? - ✔
NASBA
What is the rate of mammalian DNA replication? - ✔50 nucleotides per second
According to the wobble hypothesis, a U in the 5' position of the anit-codon can pair
with: - ✔A or G
In CML, what fusion protein is created? - ✔BCR-Abl1
This polymerase acts on DNA and produces Ribosomal RNA: - ✔RNA Pol I
What assay amplifies the probe signal and the probe RNA concentration increases if the
target to be detected is present? - ✔Qβ replicase
What translocation results in synovial sarcoma, a muscle and fibrous tissue cancer? - ✔
t(18;X)
The hydroxyl group in a deoxyribonucleotide is expected to be found on which position
of the sugar? - ✔C3'
If two parents are heterozygous for an autosomal recessive disease, then their offspring
will most likely follow this gene frequency pattern: - ✔25% homozygous dominant, 50%
heterozygous, and 25% homozygous recessive