MB ASCP CONNECT(edited version).
MB ASCP CONNECT(edited version).What is translocation is associated with Burkitt's Lymphoma? a. t(18; 14) b. t(9; 22) c. t(8; 14) d. t(15; 17) ANSWER- t(8; 14) TIP: Burkkitt's 8 letters, Locus PF Child Paternity Index LOC-A1 3 2/3 2.18 LOC-B2 7/5 5 0.798 LOC-C3 17/17 9/17 5.21 LOC-D4 12 12 1.37 Based on the data presented in the table above and with a prior probability (PP) of 0.5, the probability of paternity in this case is : a. 92.5% b. 99.5% c. 90.5 & d. 95.5% ANSWER- 92.5 % Multiply all PI together = CPI (CPI x PP) / [CPI x P + (1 - PP) OR ... CPI / (1 + CPI) You have sequenced a gene and observe the following: Reference: atgctggcacgacaggtttcccgactgg Sequenced: atgCctggcacgacaggtttcccgactgg The mutation observed is a: a. Frame-shift mutation b. Insertion c. Silent mutation d. Non-conservative mutation ANSWER- Frame-shift mutation Which of the following is not involved in the splicing reaction?
Written for
- Institution
- Mbascp
- Course
- Mbascp
Document information
- Uploaded on
- June 10, 2023
- Number of pages
- 38
- Written in
- 2022/2023
- Type
- Exam (elaborations)
- Contains
- Questions & answers
Subjects
-
in the field of mol
-
mb ascp connectedited version
-
locus pf child paternity index loc a1 3 23 218
-
you have sequenced a gene and observe the foll
-
which of the following is not involved in the spli