MB ASCP Demo Practice Exam Questions

MB ASCP Demo Practice Exam Questions1. Given the anti-sense strand of DNA: 5'-AATTGCCGACATAGAT-3' which is the appropriate sense strand? A. 5'-ATCTATGTCGGCAATT-3' B. 5'-TTAACGGCTGTATCTA-3' C. 5'-AATTGCCGACATAGAT-3' D. 5'-GAGCACGCTATCTTAT-3' - ANSWERA. 5'-ATCTATGTCGGCAATT-3' 2. Consider the probe sequence, CTACCGTAATATTCGACCGT, to be used in a hybridization procedure. What is the melting temperature, Tm, of the sequence? A. 60°C B. 58°C C. 64°C D. 62°C - ANSWERB. 58°C 3. What assay amplifies the target using a combination of a three-enzyme system? A. Branched DNA B. TMA C. PCR D. NASBA E. LCR - ANSWERD. NASBA 4. All of the following enzymes are part of the DNA replication machinery, EXCEPT: A. Ligase B. DNA polymerase C. Luciferase D. Helicase - ANSWERC. Luciferase 5. In real-time PCR, what is amplified? A. The target B. The signal C. The probe D. All of the above - ANSWERA. The target 6. All of the following are components of nucleic acids, EXCEPT: A. Phosphate group B. Sugar (ribose or deoxyribose) C. Nitrogenous base (A, G, C, T) D. Formamide - ANSWERD. Formamide