MB ASCP Chapter 1 Study Questions and Answers.

MB ASCP Chapter 1 Study Questions and Answers.What is the function of DNA in the cell - aANSWERCarry genetic information How do purines and pyrimidines - aANSWERPurines have double ring; pyrimidines have a single ring Write the complementary sequence for the following DNA sequence 5' AGGTCACGTCTAGCTAGCTAGA 3' - aANSWER5' AGGTCACGTCTAGCTAGCTAGA 3' Answer: 5' TCTAGCTAGCTAGACGTGACCT 3' Which of the ribose carbons participate in the phosphodiester bond - aANSWERThe 5' ribose carbon carries the phosphate group that forms a phosphodiester bond with the hydroxyl group on the 3' ribose carbon Which ribose carbon carries the nitrogen base - aANSWERThe 1' carbon of the ribose carries the nitrogen base Why does DNA Polymerase require primase activity - aANSWERDNA polymerase cannot begin synthesis without a 3' OH group What is the covalent bond b/t nucleotides catazyled by dna polymerase - aANSWERPhosphodiester bond Is DNA replication conservative or semi-conservative? - aANSWERSemi-conservative What is the lagging strand in dna synthesis - aANSWERDuring DNA replication, the lagging strand is the strand positioned 5' to 3' with respect to the direction of synthesis, requiring the replication assembly to jump ahead and read 3' to 5' back toward the moving replication fork. The leading strand is read continuously 3' to 5'. Synthesis thus proceeds 5' to 3' on both strands. Short pieces of dna involved in dna synthesis in replicating cells are called - aANSWERokazaki fragments Name function of following enzymes Polymerase Helicase Primase