ASP Final - 76 Questions from Exams
all correctly answered
DNA codes for proteins that have specific functions, the proteins of interest in drug
therapy include what? Correct Answer: Receptors, transporters, metabolizing
enzymes
The DNA sequencing method with the synonyms "Sanger method" and "chain
terminating method" is based on what? Correct Answer: Incorporation of a
dideoxynucleotide in the chain
Gel electrophoresis relative to strands of DNA can do what? Correct Answer:
Separate DNA strands by as little as one nucleoside base
In amplification of DNA, what is required to initiate the formation of
complementary (or daughter) DNA strands from the template strand? Correct
Answer: Primers
Why do DNA "chain terminators" stop the expansion of a DNA strand? Correct
Answer: They lack the 3' hydroxyl group
Strand 1: GCCGTCGTAACGGG
Strand 2: ACGGGCTCTGTCAGGTCGTCCA
Strand 3: GTCCAGTCGATGGCCTT
If the last base in each strand were the terminal base with a fluorescent dye
attached, what would the DNA sequence be, once the strands passed through a gel
electrophoresis system? Correct Answer: GTA
The relative risk of developing stomach cancer from drinking coffee is 1.8 [0.7 to
3.7]. What is the association/correlation between coffee and cancer? Correct
Answer: There is no association between coffee and stomach cancer based on this
data
What is the best measure to compare the outcomes among various different studies
to create a level playing field for looking at the results? Correct Answer: Number
needed to treat
, Parametric statistics require 2 assumptions to be utilized appropriately by a
researcher. One assumption is that the data must be interval level data. What is the
other assumption? Correct Answer: Normally distributed or sample size greater
than or equal to 30
The gold standard of OBSERVATIONAL study designs that measures TRUE rate
(relative risk) rather than estimating the rate is? Correct Answer: Cohort
What is the odds ration an estimate of? Correct Answer: Relative risk
What is a study that reflects more of the real world setting and includes patients
with more than one disease state? Correct Answer: Effectiveness study
When will you not float at the surface of a fresh water lake? Correct Answer:
When your average body density is less than the density of fresh water
A neuron star has a mass of 2.50 x 10^28 kg and a density of 3.93 x 10^18 kg/m^3.
What is its volume? Correct Answer: 6.36 x 10^9 m^3
You are lying down on a bed of 3000 nails (I'm not sure why). Your body weight of
695 N is evenly distributed among the nails. Each nail has a tip diameter of 1.00
nm. What is the pressure at each nail point? Correct Answer: 2.95 x 10^5 Pa
For a hydraulic lift in a car garage designed to lift up a car using a relatively small
input force, what must be true about the force and pressure on the input versus the
output piston? Correct Answer: The force on the input piston is less than the force
on the output piston.
The pressure on the input piston is equal to the pressure on the output piston.
What is Archimedes' principle? Correct Answer: An object submerged (partially or
wholly) in a fluid experiences an upward buoyant force. The buoyant force is equal
in magnitude to the weight of the fluid displaced by the object.
An athlete is weighted in the air and then in water. Assume that the athlete is
completely submerged in the fluid while weighing is done. the scale reading in air
was 750 N. The athlete's average body density was determined to be 1.04 x 10^3
kg/m^3. What's the volume of the athlete's body and the athlete's apparent weight
in water (the scale's reading in water)? Correct Answer: 0.0736 m^3
29.0 N
all correctly answered
DNA codes for proteins that have specific functions, the proteins of interest in drug
therapy include what? Correct Answer: Receptors, transporters, metabolizing
enzymes
The DNA sequencing method with the synonyms "Sanger method" and "chain
terminating method" is based on what? Correct Answer: Incorporation of a
dideoxynucleotide in the chain
Gel electrophoresis relative to strands of DNA can do what? Correct Answer:
Separate DNA strands by as little as one nucleoside base
In amplification of DNA, what is required to initiate the formation of
complementary (or daughter) DNA strands from the template strand? Correct
Answer: Primers
Why do DNA "chain terminators" stop the expansion of a DNA strand? Correct
Answer: They lack the 3' hydroxyl group
Strand 1: GCCGTCGTAACGGG
Strand 2: ACGGGCTCTGTCAGGTCGTCCA
Strand 3: GTCCAGTCGATGGCCTT
If the last base in each strand were the terminal base with a fluorescent dye
attached, what would the DNA sequence be, once the strands passed through a gel
electrophoresis system? Correct Answer: GTA
The relative risk of developing stomach cancer from drinking coffee is 1.8 [0.7 to
3.7]. What is the association/correlation between coffee and cancer? Correct
Answer: There is no association between coffee and stomach cancer based on this
data
What is the best measure to compare the outcomes among various different studies
to create a level playing field for looking at the results? Correct Answer: Number
needed to treat
, Parametric statistics require 2 assumptions to be utilized appropriately by a
researcher. One assumption is that the data must be interval level data. What is the
other assumption? Correct Answer: Normally distributed or sample size greater
than or equal to 30
The gold standard of OBSERVATIONAL study designs that measures TRUE rate
(relative risk) rather than estimating the rate is? Correct Answer: Cohort
What is the odds ration an estimate of? Correct Answer: Relative risk
What is a study that reflects more of the real world setting and includes patients
with more than one disease state? Correct Answer: Effectiveness study
When will you not float at the surface of a fresh water lake? Correct Answer:
When your average body density is less than the density of fresh water
A neuron star has a mass of 2.50 x 10^28 kg and a density of 3.93 x 10^18 kg/m^3.
What is its volume? Correct Answer: 6.36 x 10^9 m^3
You are lying down on a bed of 3000 nails (I'm not sure why). Your body weight of
695 N is evenly distributed among the nails. Each nail has a tip diameter of 1.00
nm. What is the pressure at each nail point? Correct Answer: 2.95 x 10^5 Pa
For a hydraulic lift in a car garage designed to lift up a car using a relatively small
input force, what must be true about the force and pressure on the input versus the
output piston? Correct Answer: The force on the input piston is less than the force
on the output piston.
The pressure on the input piston is equal to the pressure on the output piston.
What is Archimedes' principle? Correct Answer: An object submerged (partially or
wholly) in a fluid experiences an upward buoyant force. The buoyant force is equal
in magnitude to the weight of the fluid displaced by the object.
An athlete is weighted in the air and then in water. Assume that the athlete is
completely submerged in the fluid while weighing is done. the scale reading in air
was 750 N. The athlete's average body density was determined to be 1.04 x 10^3
kg/m^3. What's the volume of the athlete's body and the athlete's apparent weight
in water (the scale's reading in water)? Correct Answer: 0.0736 m^3
29.0 N
