Geschreven door studenten die geslaagd zijn Direct beschikbaar na je betaling Online lezen of als PDF Verkeerd document? Gratis ruilen 4,6 TrustPilot
logo-home
Tentamen (uitwerkingen)

AMCB 2023 Test Questions with Correct Answers

Beoordeling
-
Verkocht
-
Pagina's
5
Cijfer
A+
Geüpload op
19-12-2023
Geschreven in
2023/2024

AMCB 2023 Test Questions with Correct Answers To verify DNA purity we have to: - Answer-Measure absorbance at 260 nm and 280 nm. The addition of proteinase K in the buffer ATL is to: - Answer-Disrupt the cell envelope to lyse cells. The genomic DNA that we extract from cells (of any kind) is polar and sticky. This property is useful for purification purposes. Which of the following surfaces is likely to be used, with good efficiency, to purify DNA. - Answer-A glass rod/bar To quantify DNA we should: - Answer-Measure absorbance at 260 nm. In this course the use of a chimera or chimerical molecule is applied to: - AnswerGenetic recombinant molecules. Select the group describing the type of DNA vectors mentioned in the course: - AnswerShuttle vectors - Expression plasmids - Reporter plasmids - Suicide plasmids Extraction protocol: Once the bacterial cells are lysed and the cell free extracts are loaded into the column, the plasmids will: - Answer-Be retained on the filter made of glass fibers. The gene SacB encodes for: - Answer-A) The enzyme levan sucrase. B) A toxic enzyme when expressed in E. coli. Select the best definition of a PLASMID: - Answer-A circular genetic structure that replicates independently of the chromosome The use of plasmids is extremely flexible, including the use of viral genes to be inserted and expressed in different kinds of cells. - Answer-True A general characteristic of the plasmids used in biotechnology is a gene conferring antibiotic resistance - Answer-True

Meer zien Lees minder
Instelling
AMCB 2023
Vak
AMCB 2023

Voorbeeld van de inhoud

AMCB 2023 Test Questions with Correct Answers To verify DNA purity we have to: - Answer -Measure absorbance at 260 nm and 280 nm. The addition of proteinase K in the buffer ATL is to: - Answer -Disrupt the cell envelope to lyse cells. The genomic DNA that we extract from cells (of any kind) is polar and sticky. This property is useful for purification purposes. Which of the following surfaces is likely to be used, with good efficiency, to purify DNA. - Answer -A glass rod/bar To quantify DNA we should: - Answer -Measure absorbance at 260 nm. In this course the use of a chimera or chimerical molecule is applied to: - Answer -
Genetic recombinant molecules. Select the group describing the type of DNA vectors mentioned in the course: - Answer -
Shuttle vectors - Expression plasmids - Reporter plasmids - Suicide plasmids Extraction protocol: Once the bacterial cells are lysed and the cell free extracts are loaded into the column, the plasmids will: - Answer -Be retained on the filter made of glass fibers. The gene SacB encodes for: - Answer -A) The enzyme levan sucrase. B) A toxic enzyme when expressed in E. coli. Select the best definition of a PLASMID: - Answer -A circular genetic structure that replicates independently of the chromosome The use of plasmids is extremely flexible, including the use of viral genes to be inserted and expressed in different kinds of cells. - Answer -True A general characteristic of the plasmids used in biotechnology is a gene conferring antibiotic resistance - Answer -True The bla gene in p15TV -L used in this lab encodes for: - Answer -B) B-lactamase. C) Resistance to ampicillin. In the p15TV -L vector, the SacB gene will be used for: - Answer -A) Directional selection of recombinant molecules. B) Killing E. coli cells with non -recombinant plasmids. Which of the following sentences is NOT true: - Answer -A) Plasmids can be used to express heterologous genes in a different genetic background. Correct B)Plasmids can be used to transform a Prokaryotic cell into a Eukaryotic cell. C) Plasmids (called shuttle vectors) can be used to transfer genetic information from Gram negative cells to Gram positives. D) A plasmid expressing GFP will make the recipient strain fluoresce green when exposed to UV light. The best technique used to quickly purify individual DNA fragments from a mixture is___________. - Answer -Removing the DNA bands from a gel, melting the agarose and recovering the DNA with a column. During the plasmid extraction process several solutions are used to disrupt the cells and purify the nucleic acids. The process usually generates some degree of fragmentation in the extracted plasmids. Which of those three forms is assumed to be the native form (or biological form) inside the cells cytoplasm? - Answer -Circular supercoiled The liquid used to fill the running tank is_________? - Answer -Ionic buffer Select the correct sequence of events that take place during PCR amplification. - Answer -full denaturation - denaturation - annealing (primer dependent) - extension (fragment length dependent) - full extension Which of the following is the correct name of the machine used to perform polymerase chain reactions? - Answer -Thermocycler Correct Reverse primer 5'ATGATGATGATGATGATGCCTCCTCCTCCTCCTCCTCCTCCTCCTCCT - Answer -
5'AGGAGGAGGAGGAGG This Figure shows the target sequence with two colors; blue for the positive strand and black for the negative. The primers are depicted as usual; red for the complementary region and green for extra sequences. To which strand will the red portion of the REVERSE primer hybridize with? - Answer -Blue strand Which component is missing in this PCR mixture: polymerase - buffer - forward primer - reverse primer - magnesium - dNTPs and ___________? - Answer -Target sequence

Geschreven voor

Instelling
AMCB 2023
Vak
AMCB 2023

Documentinformatie

Geüpload op
19 december 2023
Aantal pagina's
5
Geschreven in
2023/2024
Type
Tentamen (uitwerkingen)
Bevat
Vragen en antwoorden

Onderwerpen

$11.39
Krijg toegang tot het volledige document:

Verkeerd document? Gratis ruilen Binnen 14 dagen na aankoop en voor het downloaden kun je een ander document kiezen. Je kunt het bedrag gewoon opnieuw besteden.
Geschreven door studenten die geslaagd zijn
Direct beschikbaar na je betaling
Online lezen of als PDF

Maak kennis met de verkoper

Seller avatar
De reputatie van een verkoper is gebaseerd op het aantal documenten dat iemand tegen betaling verkocht heeft en de beoordelingen die voor die items ontvangen zijn. Er zijn drie niveau’s te onderscheiden: brons, zilver en goud. Hoe beter de reputatie, hoe meer de kwaliteit van zijn of haar werk te vertrouwen is.
Stuviaascorers University of Washington
Volgen Je moet ingelogd zijn om studenten of vakken te kunnen volgen
Verkocht
367
Lid sinds
3 jaar
Aantal volgers
185
Documenten
11068
Laatst verkocht
1 week geleden
StuviaAscorers | Top Study Notes & Exam Solutions

Stuviaascorers – Your #1 Source for Top-Quality Study Materials! Struggling with exams? Stuviaascorers has got you covered! I provide expertly crafted study notes, summaries, past papers, and exam-ready answers to help you pass with flying colors. My materials are designed for clarity, accuracy, and success—so you can study smarter, not harder! Why Choose My Study Materials? Well-structured & easy to understand – No fluff, just what you need! Exam-focused & high-scoring content – Get straight to the point! Accurate answers & clear explanations – Learn with confidence! Save time & boost your grades – Study efficiently! Don’t leave your success to chance! Browse my documents and start acing your exams today!

Lees meer Lees minder
3.8

65 beoordelingen

5
31
4
11
3
11
2
2
1
10

Recent door jou bekeken

Waarom studenten kiezen voor Stuvia

Gemaakt door medestudenten, geverifieerd door reviews

Kwaliteit die je kunt vertrouwen: geschreven door studenten die slaagden en beoordeeld door anderen die dit document gebruikten.

Niet tevreden? Kies een ander document

Geen zorgen! Je kunt voor hetzelfde geld direct een ander document kiezen dat beter past bij wat je zoekt.

Betaal zoals je wilt, start meteen met leren

Geen abonnement, geen verplichtingen. Betaal zoals je gewend bent via iDeal of creditcard en download je PDF-document meteen.

Student with book image

“Gekocht, gedownload en geslaagd. Zo makkelijk kan het dus zijn.”

Alisha Student

Bezig met je bronvermelding?

Maak nauwkeurige citaten in APA, MLA en Harvard met onze gratis bronnengenerator.

Bezig met je bronvermelding?

Veelgestelde vragen