Biology 210 Exam 1 CH 1 5 Practice
questions with answers
The outer most electron shell - answersThe valence electron shell of an atom is
________?
On the interior of the proton - answersIn non polar amino acids, which part of the protein
would you begin looking for members of this class of amino acids in a protein formed in
the cell cytoplasm?
Three - answersIf an atom has 5 valence electrons, how many covalent bonds can it
make?
Amine - answersWhich functional group is potentially positively charged?
One - answersA hydrogen atom has only one shell in its valence shell. How many
covalent bonds can it form?
Monosaccharide called glucose - answersThe monomer found in the polysaccharides
starch, glycogen and cellulose is a __________.
RNA sequence - answersFor the nucleotide sequence,
UUAGCUUCCUUCUCCGUCCAAGACAGCAGCAGCCAGUCACAGACCAGGAUGAAG
UCCAUCCAGUUCUGCUUCUUUU What nucleic acid is represented here?
All three kinds of bonds - answersWhat kinds of bonds stabilize the protein tertiary
structure? 1.) ionic bonds 2.) covalent bonds 3.) hydrogen bonds 4.) all three kinds of
bonds
Eight - answersIf an atom has an atomic number of 8 and an atomic mass of 16. How
many neutrons are in the nucleus?
questions with answers
The outer most electron shell - answersThe valence electron shell of an atom is
________?
On the interior of the proton - answersIn non polar amino acids, which part of the protein
would you begin looking for members of this class of amino acids in a protein formed in
the cell cytoplasm?
Three - answersIf an atom has 5 valence electrons, how many covalent bonds can it
make?
Amine - answersWhich functional group is potentially positively charged?
One - answersA hydrogen atom has only one shell in its valence shell. How many
covalent bonds can it form?
Monosaccharide called glucose - answersThe monomer found in the polysaccharides
starch, glycogen and cellulose is a __________.
RNA sequence - answersFor the nucleotide sequence,
UUAGCUUCCUUCUCCGUCCAAGACAGCAGCAGCCAGUCACAGACCAGGAUGAAG
UCCAUCCAGUUCUGCUUCUUUU What nucleic acid is represented here?
All three kinds of bonds - answersWhat kinds of bonds stabilize the protein tertiary
structure? 1.) ionic bonds 2.) covalent bonds 3.) hydrogen bonds 4.) all three kinds of
bonds
Eight - answersIf an atom has an atomic number of 8 and an atomic mass of 16. How
many neutrons are in the nucleus?
