MB (ASCP) EXAM ATCUAL EXAM 300 QUESTIONS AND
CORRECT DETAILED ANSWERS (100% VERIFIED
ANSWERS) |ALREADY GRADED A+
The enzyme that primes DNA synthesis is: - ANSWER: DNA primase
Which of the following is a common hydrogen bond acceptor?
a) A carbonyl
b) Primary amine
c) Hydroxyl
d) Tertiary amine - ANSWER: b) Primary amine
What assay is a signal amplification test and uses Alkaline Phosphatase?
a) Branched DNA
b) TMA
c) PCR
d) NASMA
e) LCR - ANSWER: a) Branched DNA
Which one of the following complementary pairings is incorrect?
a) A=T
b) G=C
c) U=T
d) A=U - ANSWER: c) U=T
This highly polymorphic loci region is crucial in assessing immune system
compatibility: - ANSWER: HLA
What does the MSI test detect? - ANSWER: Microsatellite instability
Sickle cell disease is an autosomal genetic disease due to a point mutation in the
beta-globin gene, where glutamic acid is substituted for valine at the sixth codon of
the gene, resulting in a faulty hemoglobin S (Hb S). Sickle cell disease is one of many
genetic diseases where a single gene controls the expression of many phenotypic
traits is referred to as: - ANSWER: Pleiotrophy
How many hydrogen bonds are formed between one A:T base pair? C:G base pair? -
ANSWER: 2; 3
What is the name of the molecule that is added to the 5' end of eukaryotic RNA
transcripts? - ANSWER: GTP
, What gene is measured following treatment with imatinib (Gleevec)?
a) FLT3
b) BCR/Abl
c) Jak2
d) MAPK - ANSWER: b) BCR/Able
The bond between a phosphate group and the ribose sugar group in RNA is called
what? - ANSWER: Glycosidic bond
A parent has an autosomal dominant disorder. What percent chance does this
parent have to pass down this affected gene to his/her child? - ANSWER: 50%
This phosphate group in a nucleotide is expected to be found on which position of
the sugar?
a) C1'
b) C2'
c) C4'
d) C5' - ANSWER: d) C5'
What genes would be screened in a lung cancer panel? - ANSWER: KRAS, EGFR, ALK
Testing for Aldehyde Dehydrogenase deficiency is important in patients with: -
ANSWER: Alcohol dependence
What is the sequence of the -10 region of prokaryotic promoters? - ANSWER:
TATAAT
Deletion in the paternal chromosome 15: del(15)(q11q13) results in Prader-willi
syndrome. However, deletion in the same region in the maternal chromosome
results in a completely different condition known as Angelman syndrome. This
phenomenon is an example of: - ANSWER: Genomic imprinting
What are some characteristics of a melt curve analysis? - ANSWER: -At melting point,
the probe separates from the target strand and fluorescence rapidly decreases
-The melting temperature of double stranded DNA depends on its base composition
and length
-All PCR products for a specific primer pair should have the same melting
temperature
How is warfarin dosage affected in patients with VKORC1 deficiency? - ANSWER:
Patients receive a lower warfarin dose
You have sequenced a gene and observe the following:
Reference: atgctggcacgacaggtttcccgactgg
CORRECT DETAILED ANSWERS (100% VERIFIED
ANSWERS) |ALREADY GRADED A+
The enzyme that primes DNA synthesis is: - ANSWER: DNA primase
Which of the following is a common hydrogen bond acceptor?
a) A carbonyl
b) Primary amine
c) Hydroxyl
d) Tertiary amine - ANSWER: b) Primary amine
What assay is a signal amplification test and uses Alkaline Phosphatase?
a) Branched DNA
b) TMA
c) PCR
d) NASMA
e) LCR - ANSWER: a) Branched DNA
Which one of the following complementary pairings is incorrect?
a) A=T
b) G=C
c) U=T
d) A=U - ANSWER: c) U=T
This highly polymorphic loci region is crucial in assessing immune system
compatibility: - ANSWER: HLA
What does the MSI test detect? - ANSWER: Microsatellite instability
Sickle cell disease is an autosomal genetic disease due to a point mutation in the
beta-globin gene, where glutamic acid is substituted for valine at the sixth codon of
the gene, resulting in a faulty hemoglobin S (Hb S). Sickle cell disease is one of many
genetic diseases where a single gene controls the expression of many phenotypic
traits is referred to as: - ANSWER: Pleiotrophy
How many hydrogen bonds are formed between one A:T base pair? C:G base pair? -
ANSWER: 2; 3
What is the name of the molecule that is added to the 5' end of eukaryotic RNA
transcripts? - ANSWER: GTP
, What gene is measured following treatment with imatinib (Gleevec)?
a) FLT3
b) BCR/Abl
c) Jak2
d) MAPK - ANSWER: b) BCR/Able
The bond between a phosphate group and the ribose sugar group in RNA is called
what? - ANSWER: Glycosidic bond
A parent has an autosomal dominant disorder. What percent chance does this
parent have to pass down this affected gene to his/her child? - ANSWER: 50%
This phosphate group in a nucleotide is expected to be found on which position of
the sugar?
a) C1'
b) C2'
c) C4'
d) C5' - ANSWER: d) C5'
What genes would be screened in a lung cancer panel? - ANSWER: KRAS, EGFR, ALK
Testing for Aldehyde Dehydrogenase deficiency is important in patients with: -
ANSWER: Alcohol dependence
What is the sequence of the -10 region of prokaryotic promoters? - ANSWER:
TATAAT
Deletion in the paternal chromosome 15: del(15)(q11q13) results in Prader-willi
syndrome. However, deletion in the same region in the maternal chromosome
results in a completely different condition known as Angelman syndrome. This
phenomenon is an example of: - ANSWER: Genomic imprinting
What are some characteristics of a melt curve analysis? - ANSWER: -At melting point,
the probe separates from the target strand and fluorescence rapidly decreases
-The melting temperature of double stranded DNA depends on its base composition
and length
-All PCR products for a specific primer pair should have the same melting
temperature
How is warfarin dosage affected in patients with VKORC1 deficiency? - ANSWER:
Patients receive a lower warfarin dose
You have sequenced a gene and observe the following:
Reference: atgctggcacgacaggtttcccgactgg
