Written by students who passed Immediately available after payment Read online or as PDF Wrong document? Swap it for free 4.6 TrustPilot
logo-home
Exam (elaborations)

MB ASCP Exam Questions

Rating
-
Sold
-
Pages
37
Grade
A+
Uploaded on
01-12-2024
Written in
2024/2025

MB ASCP Exam Questions

Institution
Course

Content preview

MB ASCP Exam Questions (Newest 2024/2025) With
Complete Solutions
What is translocation is associated with Burkitt's Lymphoma?

a. t(18; 14)
b. t(9; 22)
c. t(8; 14)
d. t(15; 17) - ANSWERt(8; 14)

TIP: Burkkitt's 8 letters,

Locus PF Child Paternity Index

LOC-A1 3 2/3 2.18
LOC-B2 7/5 5 0.798
LOC-C3 17/17 9/17 5.21
LOC-D4 12 12 1.37

Based on the data presented in the table above and with a prior probability (PP) of
0.5, the probability of paternity in this case is :

a. 92.5%
b. 99.5%
c. 90.5 &
d. 95.5% - ANSWER92.5 %

Multiply all PI together = CPI

(CPI x PP) / [CPI x P + (1 - PP)
OR ...
CPI / (1 + CPI)

You have sequenced a gene and observe the following:

Reference: atgctggcacgacaggtttcccgactgg

Sequenced: atgCctggcacgacaggtttcccgactgg

The mutation observed is a:

a. Frame-shift mutation
b. Insertion
c. Silent mutation
d. Non-conservative mutation - ANSWERFrame-shift mutation

,Which of the following is not involved in the splicing reaction?

a. 5' splice site
b. Hairpin loops
c. Branch A point
d. 3' splice site - ANSWERHairpin loops

Which of the following statements are characteristics of the melt curve analysis?
(hint: more than one answer)

a. At the melting point, the probe separates from the target strand and fluorescence
rapidly decreases.
b. The melting temperature of double stranded DNA depends on its base
composition and length.
c. All PCR products for a specific primer pair should have the same melting
temperature.
d. When hybridization probes are utilized, the temperature is incrementally
decreased while fluorescence is monitored. - ANSWERAt the melting point, the
probe separates from the target strand and fluorescence rapidly decreases.

The melting temperature of double stranded DNA depends on its base composition
and length.

All PCR products for a specific primer pair should have the same melting
temperature.

In the field of molecular diagnostics, which one of the following genes is responsible
for the synthesis of DNA, promote cell division, and inhibit cell death?

a. Proto-oncogenes
b. Tumor suppressor genes
c. Oncogenes
d. Mitochondrial genes - ANSWERProto-oncogenes

Microsatellite instability is best described as:

a. The ability of a gene with repeating elements of 8-10 base pairs to randomly
mutate
b. Contraction or expansion of the genome caused by frameshift mutations
(deletions or insertions) in elements of the genome consisting of a repeating
sequence of 1-3 base pairs
c. Repetitive elements in the genome with the ability to self-prime, thus creating
additional copies of genetic material at the allele loci
d. Random gene rearrangement between repeating elements of the same size on
different chromosomes resulting in different size gene products -
ANSWERContraction or expansion of the genome caused by frameshift mutations

,(deletions or insertions) in elements of the genome consisting of a repeating
sequence of 1-3 base pairs

Purines and pyrimidines differ from each other in that:

a. Purines are found RNA; pyrimidines are found in DNA
b. There's no difference between purines and pyrimidines
c. Pyrimidines have two rings; purines have one ring
d. Purines have two rings; pyrimidines have one ring - ANSWERPurines have two
rings; pyrimidines have one ring

TIP: Reciprocals of each other.
Purine, shorter word, longer rings.
Pyrimidine, longer word, shorter ring.

Which of the following molecular methodologies would be the best for detecting a
trinucleotide repeat disorder such as Huntington's disease?

a. Heteroduplex analysis
b. Variable number tandem repeat analysis
c. Single strand conformation polymorphism analysis
d. Reverse-Transcriptase PCR - ANSWERVariable number tandem repeat analysis

Locus Test C M PF1 PF2

A1 12/15 12 15/17 12/15
B2 13 13/13 13/15 14/15
C3 7/8 8 7 7/7
D4 9/11 9/9 10/11 11
E5 6 6/6 5/7 6

Based on the results above, which one of the two possible fathers is the two-month
old's biological father?

a. Possible Father 1
b. Possible Father 2
c. Neither of the Possible Fathers - ANSWERNeither

Sickle cell disease is an autosomal genetic disease due to a point mutation in the
beta-globin gene, where glutamic acid is substituted for valine at the sixth codon of
the gene, resulting in a faulty hemoglobin S (Hb S). Sickle cell disease is one of many
genetic diseases where a single gene controls the expression of many phenotypic
traits. The phenomenon where a single gene controls the expression of many
phenotypic traits is best referred to as:

a. Pleiotrophy
b. Polygenic inheritance

, c. Epistasis
d. Epigenetics - ANSWERPleiotrophy

A technologist uses the spectrophotometer to quantify the amount of DNA extracted
from a blood specimen diluted 1:30. The absorbance reading at 260 nm was found to
be 2.545. If the absorbance at 280 nm gave a reading of 1.406, and if the the DNA
extract was re-suspended in 0.800 mL of EDTA solution, the DNA yield is:

a. 3540 micrograms
b. 3450 micrograms
c. 3504 micrograms
d. 3054 micrograms - ANSWER3054 ug

260 reading x 50 ug/ml (DNA) x dilution factor x resupsension = DNA Yield

260 x 50 x 30 x 0.8 = 3054

When sequencing HLA-DR what is targeted?

a. Exon 1 of the α subunit
b. Exon 2 of the α subunit
c. Exon 1 of the β subunit
d. Exon 2 of the β subunit - ANSWERExon 2 of the β subunit

All of the following are components of nucleic acids, EXCEPT:

a. Phosphate group
b. Sugar (ribose or deoxyribose)
c. Nitrogenous base (A, G, C, T)
d. Formamide - ANSWERFormamide

This polymerase acts on DNA and produces Transfer RNA:

a. RNA Pol II
b. DNA Pol II
c. RNA Pol III
d. DNA Pol III - ANSWERRNA pol III

In mantle cell lymphoma (MCL), this is the fusion gene created:

a. EWS-FLI1
b. CCND1-IGH
c. BCR-IGH
d. c-myc-EWS - ANSWERCCND1-IGH

(Cyclin D1)

Connected book

Written for

Course

Document information

Uploaded on
December 1, 2024
Number of pages
37
Written in
2024/2025
Type
Exam (elaborations)
Contains
Questions & answers

Subjects

$18.49
Get access to the full document:

Wrong document? Swap it for free Within 14 days of purchase and before downloading, you can choose a different document. You can simply spend the amount again.
Written by students who passed
Immediately available after payment
Read online or as PDF

Get to know the seller

Seller avatar
Reputation scores are based on the amount of documents a seller has sold for a fee and the reviews they have received for those documents. There are three levels: Bronze, Silver and Gold. The better the reputation, the more your can rely on the quality of the sellers work.
knoowy0010 Teachme2-tutor
Follow You need to be logged in order to follow users or courses
Sold
5
Member since
1 year
Number of followers
0
Documents
1039
Last sold
1 month ago

4.7

141 reviews

5
112
4
14
3
12
2
3
1
0

Recently viewed by you

Why students choose Stuvia

Created by fellow students, verified by reviews

Quality you can trust: written by students who passed their tests and reviewed by others who've used these notes.

Didn't get what you expected? Choose another document

No worries! You can instantly pick a different document that better fits what you're looking for.

Pay as you like, start learning right away

No subscription, no commitments. Pay the way you're used to via credit card and download your PDF document instantly.

Student with book image

“Bought, downloaded, and aced it. It really can be that simple.”

Alisha Student

Working on your references?

Create accurate citations in APA, MLA and Harvard with our free citation generator.

Working on your references?

Frequently asked questions