CSE 180 | 88 Questions And Answers | Complete Study
Solutions
What type of variable can have only one of two values - True or False? ANS Boolean
What does the expression True and not (False or False) return? ANS True
What does the expression True or ((not False) and False) return? ANS True
Which built-in Python data structure consists of a set of key-value pairs? ANS Dictionary
Let tea_party = ['March Hare', 'Hatter', 'Dormouse',
'Alice']
What is the value of tea_party[-1]? ANS Alice
Compute PatternCount("AAA",
"GACCATCAAAACTGATAAACTACTTAAAAATCAGT"). ANS 6
What is the reverse complement of "GATTACA" ? ANS TGTAATC
You are given the following Python code:
text="GATGCGGT"
for y in text[1:4]:
print(y)
What will be the output? ANS ATG
You are given the following Python code:
x=0
for y in range(0,5):
x += y
, print(x)
What will be the output? ANS 10
What is the most frequent 3-mer of
"CGGAGGACTCTAGGTAACGCTTATCAGGTCCATAGGACATTCA" ? ANS AGG
The position of the E. coli genome at which the skew attains a maximum
value is most likely near which of the following?
A. the origin of replication
B. the replication terminus
C. the middle of the forward strand
D. the middle of the reverse strand ANS B
(extra credit) Identify the value of i for which the skew array of
"GATACACTTCCCGAGTAGGTACTG" attains a minimum value. Report the
position of the first occurrence only, with 1-based numeration with respect
to the Genome (i.e., Skew[1] corresponds to "G" here) ANS -2
What does chip-seq do? ANS etermines protein-binding sites on DNA
Given 100-nucleotide long strings X = ATGC....CATA and Y = TATG....CTTG
with Count(X, ATAT) = 20 and Count(Y, ATAT) = 12, what is Count(X+Y,
ATAT)?
Note: X+Y denotes the concatenation of X and Y: ATGC....CATATATG....CTTG ANS 34
How many k-mers are there in a string of length n? ANS n-k+1
extra credit) What will be the output of the following Python code?
a = [0, 1, 2, 3, 4]
b=a
Solutions
What type of variable can have only one of two values - True or False? ANS Boolean
What does the expression True and not (False or False) return? ANS True
What does the expression True or ((not False) and False) return? ANS True
Which built-in Python data structure consists of a set of key-value pairs? ANS Dictionary
Let tea_party = ['March Hare', 'Hatter', 'Dormouse',
'Alice']
What is the value of tea_party[-1]? ANS Alice
Compute PatternCount("AAA",
"GACCATCAAAACTGATAAACTACTTAAAAATCAGT"). ANS 6
What is the reverse complement of "GATTACA" ? ANS TGTAATC
You are given the following Python code:
text="GATGCGGT"
for y in text[1:4]:
print(y)
What will be the output? ANS ATG
You are given the following Python code:
x=0
for y in range(0,5):
x += y
, print(x)
What will be the output? ANS 10
What is the most frequent 3-mer of
"CGGAGGACTCTAGGTAACGCTTATCAGGTCCATAGGACATTCA" ? ANS AGG
The position of the E. coli genome at which the skew attains a maximum
value is most likely near which of the following?
A. the origin of replication
B. the replication terminus
C. the middle of the forward strand
D. the middle of the reverse strand ANS B
(extra credit) Identify the value of i for which the skew array of
"GATACACTTCCCGAGTAGGTACTG" attains a minimum value. Report the
position of the first occurrence only, with 1-based numeration with respect
to the Genome (i.e., Skew[1] corresponds to "G" here) ANS -2
What does chip-seq do? ANS etermines protein-binding sites on DNA
Given 100-nucleotide long strings X = ATGC....CATA and Y = TATG....CTTG
with Count(X, ATAT) = 20 and Count(Y, ATAT) = 12, what is Count(X+Y,
ATAT)?
Note: X+Y denotes the concatenation of X and Y: ATGC....CATATATG....CTTG ANS 34
How many k-mers are there in a string of length n? ANS n-k+1
extra credit) What will be the output of the following Python code?
a = [0, 1, 2, 3, 4]
b=a
