AND GENERAL MICROBIOLOGY THEORY PRACTICAL
SECTION A
1. Princess eats 60g of oats for breakfast before her biology exam. Each gram of oats
contains three (3) molecules of glucose.
a. Assuming Princes uses 180 molecules of adenosine triphosphate in consuming breakfast
and cleaning up after breakfast, calculate the net ATP Princes has from breakfast for her
morning activities. (5 marks)
b. Describe how Princess generates the net energy from ATP by substrate level
phosphorylation for her biology exam. (15 marks)
c. State the total number of ATP generated from oxidative phosphorylation. Describe how
this number is generated. (20 marks)
2. You have been given a DNA fragment obtained from the genome of Bacillus
thuringiensis below:
3’CACTAACTGTCGCCAGGTCTGATAGACATATAACTGTTGGCGTACATA
AGAAGGATCAAAAAA5’
Additional tools are provided below.
a. Provide the complementary strand for the parent strand (above) that would be
synthesized during replication of the linear DNA fragment (10 marks)
b. List the enzymes involved in this DNA replication (4 marks)
c. Use the parent strand as a template to synthesize mRNA strand. Describe how the
mRNA strand is generated and regulated. Indicate the direction of synthesis.
(16 marks)
d. Synthesize a polypeptide from the mRNA. (10 marks)
Dr. Angela Parry-Hanson Kunadu & Dr. Joycelyn Quansah Page 1 of 3