MICRO3050 midterm EXAM QUESTIONS AND VERIFIED ANSWERS LATEST RELEASE

MICRO3050 midterm EXAM QUESTIONS AND VERIFIED ANSWERS LATEST RELEASE Leave the first rating Terms in this set (77) Which of the following DNA molecules would most likely have the highest denaturing temperature (melting temperature, Tm)? Only a single strand of the double-stranded DNA is shown.Choose one: A. ACGGTGACGGCGCGAGCGC B. ACATTCGTAGTATCGCTTTTT C. AGTTACAGTAACTAACAAAT D. AACACTTAGTTATAATTGATT A Which of the following is not a mechanism by which plasmids ensure their inheritance and maintenance during cell division? Choose one: A. low-copy-number plasmids B. carrying antibiotic resistance genes C. high-copy-number plasmids D. carrying partitioning system genes, parC, parM, and parR E. carrying self-preservation genes, known as addiction modules A Active transport is required for bacterial cells toChoose one: A. move to environments with a higher nutrient concentration. B. move large polar solutes along their concentration gradient. C. bring any charged molecule into the cell. D. exchange oxygen and carbon dioxide with the environment. E. transport solutes against their concentration gradient. E Select the true statement regarding the relationship between genotype and phenotype.Choose one: A. Some mutations will cause a change in the genotype, while others will not. B. Any change in the genotype will be reflected in the phenotype. C. Only genes that produce proteins are considered part of an organism's genotype. D. The phenotype represents the entire genome of an organism. E. The phenotype reflects only the portion of the genotype that is expressed. E Bioremediation uses microbes thatChoose one: A. can modify environmental toxins through normal metabolism. B. can reproduce rapidly and overcome other microbial species. C. can assimilate nitrogen into nitrate. D. are parts of the microbiome. A Which of these two probiotic microbes have been used to treat intestinal distress in children?Choose one: A. Streptomyces and Phytophthora B. Lactobacillus and Bifidobacterium C. Salmonella and Escherichia D. Clostridium and Staphylococcus E. Listeria and Pseudomonas B Tetracycline is an antibiotic that works by binding to the 30S subunit of bacterial ribosomes, thus inhibiting protein synthesis. This drug is able to cross the cell membrane becauseChoose one: A. as a weak acid, it forms small holes in the membrane through which it passes. B. it also binds to sugars, thereby "hitching a ride" on normal nutrients into the cell. C. as a weak base, it can cross the membrane in its uncharged form. D. it acts as a mild detergent to weaken and partially dissolve the lipid bilayer. E. it closely resembles aromatic amino acids and enters using their transport proteins. C