Geschreven door studenten die geslaagd zijn Direct beschikbaar na je betaling Online lezen of als PDF Verkeerd document? Gratis ruilen 4,6 TrustPilot
logo-home
Tentamen (uitwerkingen)

EXAM 2 (bio 151) Questions And Answers

Beoordeling
-
Verkocht
-
Pagina's
6
Cijfer
A+
Geüpload op
17-06-2025
Geschreven in
2024/2025

Tetrahymena is a genus of free-living ciliates that are common in freshwater ponds. They are model organisms used to study a variety of cellular processes, including plasma membrane fluidity. Tetrahymena can maintain homeostasis by altering the fatty acid composition of their cellular membranes. You grow Tetrahymena in normal temperatures and then expose these Tetrahymena to cold temperatures. Which of the following changes in plasma membrane composition are likely to occur? I. An increase in the concentration of unsaturated fatty acids. II. A decrease in the length of the fatty acid tails. III. A decrease in the concentration of unsaturated fatty acid tails. IV. An increase in the length of the fatty acid tails. - ANS I and II Which of the following statements about the sodium-potassium pump are true? I. The sodium-potassium pump moves potassium ions (K+) from an area of high K+ concentration to an area of low K+ concentration. II. The sodium potassium pump is a form of secondary active transport. III. The sodium-potassium pump requires ATP. - ANS III only Sodium-glucose transporters are a family of glucose transporter found in the intestinal mucosa of the small intestine and the proximal tubule of the nephron. These Na-glucose transporters are powered by the Na-K pump. Which of the following correctly describes what happens in the Na-glucose transporter? - ANS Na+ moves down its concentration gradient and glucose moves up You have a sample of cells that have not been exposed to the growth factor. Which of the following would you expect to see when you measure these cells? A. High levels of protein 1 in the cytoplasm. B. TFA is inactive and in the cytoplasm. C. High levels of protein 2 in the cytoplasm. D. SK2 is phosphorylated. E. EB3 is phosphorylated. - ANS B. TFA is inactive and in the cytoplasm. What immediately happens when a signaling molecule binds to a G-protein-coupled-receptor? A. The receptor dimerizes and phosphorylates itself. B. The G-protein binds GTP. C. The G-protein phosphorylates GDP to GTP. D. The receptor phosphorylates the G-protein. E. More than one of the above happens. - ANS B. The G-protein binds GTP. The HSC gene is only expressed in hematopoietic cells, which are adult stem cells that give rise to other blood cells. You want to obtain samples of the HSC DNA and mRNA for your experiments. You have access to white blood cells (differentiated blood cells), embryonic stem cells, and hematopoietic cells. From which cells could you obtain both HSC DNA and mRNA? a. Hematopoietic cells only b. White blood cells only c. Embryonic stem cells only d. Hematopoietic and white blood cells. e. Hematopoietic and embryonic stem cells. - ANS a. Hematopoietic cells only Which of the following statements are true regarding RNA and DNA: I. All RNA is translated to generate proteins. II. RNA nucleotides are linked by phosphodiester bonds. III. Nucleotides of both RNA and DNA contain a 5-carbon sugar. A. I only B. II only C. II and III D. I and III E. I, II, and III - ANS C. II and III An mRNA has the following sequence: 3' - AUGGAGUGCCACGUGGGCAGUAUGUGA - 5' How many amino acids long would the protein be that is translated from this mRNA? a. 4 b. 5 c. 6 d. 8 e. 9 - ANS b. 5 One of the codons for the amino acid isoleucine is 5'AUC 3'. What is the sequence of the anticodon in the tRNA that carries isoleucine to the ribosome? A. 3' AUC 5' B. 3' TAG 5' C. 3' UAG 5' D. 5' UAG 3' E. 5' TAG 3' - ANS C. 3' UAG 5' 1. Which of the following statements about this molecule are true? I. This molecule is cholesterol. II. Region A is polar and region B region is nonpolar. III. Region C is a saturated fatty acid. (region a is the head (circle), region b is the bent part of the end, region c is the straight end) A. I only B. II only C. I and II D. II and III E. I-III - ANS D. II and III (use growth factor diagram) Which of the following statements about this pathway is/are true? I. SK2 is a phosphatase. II. Expression of protein 2 after the signal is received is an example of a positive feedback loop. III. After the growth factor binds to the receptor, protein 1 will be expressed. A. II only B. III only C. II and III D. I-III E. None of the statements are true - ANS B. III only Use the receptor kinase diagram to answer this question. Which best explains these results? Analysis of a cell with a simple kinase pathway shows the following: - The receptors and TK1 molecules are present, but not phosphorylated. - Some TK2 molecules are phosphorylated and others are not. - TFa molecules are all phosphorylated. A. Receptor-mediated endocytosis after the signal has been sent. B. An inhibitor blocks the kinase activity of the receptor. C. TFa expresses a phosphatase that targets TK1 and the receptor. D. The signal was never present to activate this pathway E. A loss-of-function mutation in TK1. - ANS C. TFa expresses a phosphatase that targets TK1 and the receptor. (use cell division diagram)

Meer zien Lees minder
Instelling
BIOLOGY 151
Vak
BIOLOGY 151

Voorbeeld van de inhoud

EXAM 2 (bio 151) Questions And
Answers




A
R
U
LA
C
O
D

, Tetrahymena is a genus of free-living ciliates that are common in freshwater ponds. They are
model organisms used to study a variety of cellular processes, including plasma membrane
fluidity. Tetrahymena can maintain homeostasis by altering the fatty acid composition of their
cellular membranes. You grow Tetrahymena in normal temperatures and then expose these
Tetrahymena to cold temperatures. Which of the following changes in plasma membrane
composition are likely to occur?




A
I. An increase in the concentration of unsaturated fatty acids.
II. A decrease in the length of the fatty acid tails.




R
III. A decrease in the concentration of unsaturated fatty acid tails.
IV. An increase in the length of the fatty acid tails. - ANS I and II

Which of the following statements about the sodium-potassium pump are true?



U
I. The sodium-potassium pump moves potassium ions (K+) from an area of high K+
concentration
LA
to an area of low K+ concentration.
II. The sodium potassium pump is a form of secondary active transport.
III. The sodium-potassium pump requires ATP. - ANS III only

Sodium-glucose transporters are a family of glucose transporter found in the intestinal mucosa
of the small
C

intestine and the proximal tubule of the nephron. These Na-glucose transporters are powered
by the Na-K
pump. Which of the following correctly describes what happens in the Na-glucose transporter? -
ANS Na+ moves down its concentration gradient and glucose moves up
O


You have a sample of cells that have not been exposed to the growth factor. Which of the
following would
D



you expect to see when you measure these cells?

A. High levels of protein 1 in the cytoplasm.
B. TFA is inactive and in the cytoplasm.
C. High levels of protein 2 in the cytoplasm.
D. SK2 is phosphorylated.
E. EB3 is phosphorylated. - ANS B. TFA is inactive and in the cytoplasm.

What immediately happens when a signaling molecule binds to a G-protein-coupled-receptor?

Geschreven voor

Instelling
BIOLOGY 151
Vak
BIOLOGY 151

Documentinformatie

Geüpload op
17 juni 2025
Aantal pagina's
6
Geschreven in
2024/2025
Type
Tentamen (uitwerkingen)
Bevat
Vragen en antwoorden

Onderwerpen

$11.89
Krijg toegang tot het volledige document:

Verkeerd document? Gratis ruilen Binnen 14 dagen na aankoop en voor het downloaden kun je een ander document kiezen. Je kunt het bedrag gewoon opnieuw besteden.
Geschreven door studenten die geslaagd zijn
Direct beschikbaar na je betaling
Online lezen of als PDF

Maak kennis met de verkoper

Seller avatar
De reputatie van een verkoper is gebaseerd op het aantal documenten dat iemand tegen betaling verkocht heeft en de beoordelingen die voor die items ontvangen zijn. Er zijn drie niveau’s te onderscheiden: brons, zilver en goud. Hoe beter de reputatie, hoe meer de kwaliteit van zijn of haar werk te vertrouwen is.
DocLaura Galen College Of Nursing
Volgen Je moet ingelogd zijn om studenten of vakken te kunnen volgen
Verkocht
159
Lid sinds
2 jaar
Aantal volgers
38
Documenten
6400
Laatst verkocht
2 weken geleden

4.2

44 beoordelingen

5
27
4
4
3
10
2
2
1
1

Recent door jou bekeken

Waarom studenten kiezen voor Stuvia

Gemaakt door medestudenten, geverifieerd door reviews

Kwaliteit die je kunt vertrouwen: geschreven door studenten die slaagden en beoordeeld door anderen die dit document gebruikten.

Niet tevreden? Kies een ander document

Geen zorgen! Je kunt voor hetzelfde geld direct een ander document kiezen dat beter past bij wat je zoekt.

Betaal zoals je wilt, start meteen met leren

Geen abonnement, geen verplichtingen. Betaal zoals je gewend bent via iDeal of creditcard en download je PDF-document meteen.

Student with book image

“Gekocht, gedownload en geslaagd. Zo makkelijk kan het dus zijn.”

Alisha Student

Bezig met je bronvermelding?

Maak nauwkeurige citaten in APA, MLA en Harvard met onze gratis bronnengenerator.

Bezig met je bronvermelding?

Veelgestelde vragen