Texas A&M Biology 111 Summer Term Lab Exam 2 Review Questions and answers correct

Texas A&M Biology 111 Summer Term Lab Exam 2 Review Questions and answers correct Why do we add chelix-resin in DNA isolation procedure? Chelex resin absorbs ions that inhibit function of Taq polymerase What are components of master mix used in PCR amplification of STRs? buffer, loading dye, dNTPs, three pairs of primers, and Taq polymerase What are the 3 steps in PCR? 1. Denaturing 2. Annealing 3. Extension/Elongation What happens in Denaturing? double stranded DNA is melted to generate two single strands by the breaking of hydrogen bonds What happens in Annealing? temperature lowered to enable DNA primers to attach to template DNA What happens in Extension/Elongation? temperature increased and new strand of DNA made by Taq polymerase enzyme If 4 pairs of primers used in PCR to detect 4 STR loci, what is the MAXIMUM number of bands you can get by using one person's genomic DNA sample as a PCR template and why? Answer is 8. If all 4 loci are homozygous, total bands would be 4. If all 4 loci are heterozygous, each produces two bands so 4 x 2 = 8. Three Factors that Affect Migration Speed of DNA in Gel Elctrophoresis agarose concentration, size of DNA, and voltage Why we used Taq polymerase to analyze STRs? What happens if you use other polymerase? Taq polymerase is heat resistant and can withstand high PCR temperatures. Other DNA polymerase would denature during the first cycle of PCR. How many copies of DNA produced after 10 cycles if start with single doubled-stranded molecule of target DNA? Answer is 1024. PCR growth is exponential via the equation 2^n where n in this case is 10. Central Dogma of Biology DNA -- transcription -- mRNA -- translation -- protein DNA sequence determines mRNA sequence which in turn determines protein sequence. How do point mutations affect amino acid structure? Some mRNA codons encode the same amino acid. If a point mutation does not change the amino acid translated, there is no difference in amino acid structure. However, if it does change, the structure and function of the overall sequence could change. Primers short/single-stranded DNA sequence used in PCR to serve as the starting point for DNA synthesis Given the following, determine the forward and reverse primer for 12 nucleotides: 5'ATGCGTGCTGATCGACATTAACGTACGATCAGCAATTTCCGACAT 3' Forward Primer: 5' ATGCGTGCTGAT 3' Reverse Primer: 5' ATGTCGGAAATT 3' Note: for reverse primer, work from the back and use base pair rules to determine complementary strand Why do cheek cells need to be lysed before setting up PCR? lysing breaks open the cells so the DNA is accessible Thermocycler Can be programmed to keep samples/reactions at specific temperatures for specific lengths of time. Several cycles of PCR can be accomplished using this instrument. What is bioinformatics? the application of computer technology and associated software to biological data If a DNA ladder has a band at 100bp and 900bp, which will run to the bottom of the gel and why? 100bp band will run closer to the bottom since smaller molecules move through agarose at a faster rate What is the purpose of the DNA ladder in gel electrophoresis? The DNA ladder is used to calibrate electrophoresis gel so sample of unknown DNA introduced in the gel can be measured. Why does DNA always migrate from negative to positive? DNA molecules have a negative charge due to sugar-phosphate backbone so the move through matrix of the gel towards the positive pole. Maternal Chromosome: GTACTAGACTACTACTACTACTACTGGTG Paternal Chromosome: GTACAAGACTACTACTACTACTACTACTGGTG What is the STR sequence? What is the number of STRs on maternal chromosome? On paternal chromosome? Is individual homozygous or heterozygous? STR Sequence: CTA 5 on maternal chromosome and 6 on paternal chromosome Heterozygous (would be homozygous if the number of STRs on the maternal and paternal chromosomes were the same) Which of the following statements are true? 1. DNA has a negative charge 2. All DNA will move through the gel at the same rate 3. Electrophoresis works by running an electrical charge through the gel 4. Because of its charge, DNA will move towards the negatively charged side of the gel Statements 1 and 3 are true What are 3 plausible reasons for why there could be no visible DNA in a lane during gel electrophoresis? 1. The lane was accidentally skipped when loading the gel. 2. PCR of that sample did not work so there is no DNA fragment to be visualized. 3. The DNA sample did not contain the region PCR was supposed to amplify so there is no DNA fragment to visualize. In what phase were most of the cells in and why in the Cell Division lab? Most cells well in Interphase since a typical cell spend most of its life in the initial stage of cell growth and preparation for cell replication since cell copies DNA in preparation for mitosis. If you are using a 10x ocular lense with a 40x objective lense, what is your total magnification? (10x)(40x) = 400x If an onion root tip cell has 16 chromosomes, how many would you expect in the gamete of a plant and why? 8 chromosomes because gametes result from meiosis so are haploid Interphase Picture Prophase Picture Metaphase Picture Anaphase Picture Telophase Picture Calculate the estimated time in hours for Interphase given the following information: Phase #cells Interphase 657 Prophase 79 Metaphase 11 Anaphase 6 Telophase 4 Total 757 Answer is 20.83 hours 1. Percent of Cells in Interphase: (657/757) * 100 = 86.8% 2. Time in Hours: 24 hours * 0.868 = 20.83 What is the field diaphragm's function? It controls the area of the specimen to be illuminated by controlling how much light reaches the condenser. What is the condenser's function? It focuses bright, uniform light on the specimen (cone of light that illuminates specimen with uniform intensity across the field view). What is the illuminator's function? It provides high intensity light at the field aperture so light can travel through the condenser to the specimen. Equation for Calculating Enzyme Activity Enzyme Activity = (Absorbance/elapsed time in seconds) x 1000 Match the following two sets of terms to one another: CAP RNA Polymerase Repressor Lac z Lac y Lac I repressor protein B-galactosidase enzyme CAP site operator B-galactoside permease enzyme promoter CAP binds to CAP site RNA polymerase binds to promoter Repressor binds to operator Lac z gene encodes β-galactosidase enzyme Lac y gene encodes β-Galactoside permease enzyme Lac I gene encodes for repressor protein What is the natural substrate for B-galactosidase? lactose What is the substrate used in the Gene Expression Lab for the B-galactosidase enzyme and why? ONPG because it can form a yellow colored product o-nitrophenol. What levels of glucose and lactose would provide a high level of transcription? A low level of transcription? No transcription? Strong Transcription: glucose absent and lactose present Low Transcription: glucose present and lactose present No Transcription: glucose present or absent and lactose absent Promoter binding site for RNA polymerase and the enzyme that performs transcription Operator negative regulatory site bound by the lac repressor protein In the lac operon, the repressor... binds to allolactose and becomes inactive, allowing lac gene expression to occur Phenotype physical appearance or observable characteristics Genotype genetic constitution of an individual organism How many gametes in AaBb? How many in Hhll? 4 in AaBb: AB, Ab, aB, or ab 2 in HHll: Hl or hl What is the mendelian dihybrid cross ratio? How many offspring are homozygous recessive if there are 800 offspring total? 9:3:3:1 (this means 9 of 16 offspring are homozygous dominant and 1 of 16 offspring are homozygous recessive) 800 * (1/16) = 50 What is the mendelian monohybrid cross ratio? How many offspring are homozygous recessive if there are 200 offspring total? 3:1 (this means 3 of the 4 offsprings express the dominant traits and 1 of the 4 offspring are homozygous recessive) 200 * (1/4) = 50 Which statements about genetics and heredity are true? 1. The genotypic and phenotypic frequencies in a cross between AaBb x AaBb are always the same. 2. The genotype of a random Arabidopsis plant can be easily determined by observation with tools like compound scopes and a light to check for fluorescence. 3. The genotypic and phenotypic frequencies in a cross between AaBb x AaBb are not the same. 4. Genotype refers to the alleles an individual possesses. Statements 3 and 4 are true