BIOLOGY 210 EXAM 1 (CH. 1-5)
PRACTICE QUESTIONS AND ANSWERS
100% CORRECT
The outer most electron shell - ANSWER-The valence electron shell of an atom is
________?
On the interior of the proton - ANSWER-In non polar amino acids, which part of the
protein would you begin looking for members of this class of amino acids in a protein
formed in the cell cytoplasm?
Three - ANSWER-Nitrogen has a valence of 3. How many covalent bonds can a
nitrogen atom form with other atoms?
Covalent bonds - ANSWER-What kind of chemical bonds are involved in proteins
primary structure?
Three - ANSWER-If an atom has 5 valence electrons, how many covalent bonds can it
make?
Amine - ANSWER-Which functional group is potentially positively charged?
One - ANSWER-A hydrogen atom has only one shell in its valence shell. How many
covalent bonds can it form?
Monosaccharide called glucose - ANSWER-The monomer found in the polysaccharides
starch, glycogen and cellulose is a __________.
RNA sequence - ANSWER-For the nucleotide sequence,
UUAGCUUCCUUCUCCGUCCAAGACAGCAGCAGCCAGUCACAGACCAGGAUGAAG
UCCAUCCAGUUCUGCUUCUUUU What nucleic acid is represented here?
All three kinds of bonds - ANSWER-What kinds of bonds stabilize the protein tertiary
structure? 1.) ionic bonds 2.) covalent bonds 3.) hydrogen bonds 4.) all three kinds of
bonds
Eight - ANSWER-If an atom has an atomic number of 8 and an atomic mass of 16. How
many neutrons are in the nucleus?
Hydrolysis reaction - ANSWER-The chemical reaction by which water is added to a
covalent bond connecting two monomers that breaks the connecting bonds and makes
them separate monomers is called?
PRACTICE QUESTIONS AND ANSWERS
100% CORRECT
The outer most electron shell - ANSWER-The valence electron shell of an atom is
________?
On the interior of the proton - ANSWER-In non polar amino acids, which part of the
protein would you begin looking for members of this class of amino acids in a protein
formed in the cell cytoplasm?
Three - ANSWER-Nitrogen has a valence of 3. How many covalent bonds can a
nitrogen atom form with other atoms?
Covalent bonds - ANSWER-What kind of chemical bonds are involved in proteins
primary structure?
Three - ANSWER-If an atom has 5 valence electrons, how many covalent bonds can it
make?
Amine - ANSWER-Which functional group is potentially positively charged?
One - ANSWER-A hydrogen atom has only one shell in its valence shell. How many
covalent bonds can it form?
Monosaccharide called glucose - ANSWER-The monomer found in the polysaccharides
starch, glycogen and cellulose is a __________.
RNA sequence - ANSWER-For the nucleotide sequence,
UUAGCUUCCUUCUCCGUCCAAGACAGCAGCAGCCAGUCACAGACCAGGAUGAAG
UCCAUCCAGUUCUGCUUCUUUU What nucleic acid is represented here?
All three kinds of bonds - ANSWER-What kinds of bonds stabilize the protein tertiary
structure? 1.) ionic bonds 2.) covalent bonds 3.) hydrogen bonds 4.) all three kinds of
bonds
Eight - ANSWER-If an atom has an atomic number of 8 and an atomic mass of 16. How
many neutrons are in the nucleus?
Hydrolysis reaction - ANSWER-The chemical reaction by which water is added to a
covalent bond connecting two monomers that breaks the connecting bonds and makes
them separate monomers is called?
