1
bio 1107 exam 3
BIOL 1107: Principles of Biology I Exam3- (Latest 2026/ 2027 Update)
Review| 100% Verified Questions & Answers | Grade A.
Scientists use reverse transcriptase enzymes to make DNA from RNA - ANS Which event
contradicts the central dogma of molecular biology?
For 200 commonly occurring amino acids, codons consisting of four types of nucleotides
would have to be at least four nucleotides long, because 44 = 256. There would be much
less degeneracy in this case. - ANS Imagine if there were 200 commonly occurring amino
acids instead of 20. Given what you know about the genetic code, what would be the
shortest possible codon length? Explain.
Codons that specify the same amino acid typically only differ by one nucleotide. In
addition, amino acids with chemically similar side chains are encoded by similar codons.
This nuance of the genetic code ensures that a single-nucleotide substitution mutation
might either specify the same amino acid and have no effect, or may specify a similar
amino acid, preventing the protein from being rendered completely nonfunctional. -
ANS Discuss how degeneracy of the genetic code makes cells more robust to mutations.
bio 1107 exam 3
, 2
bio 1107 exam 3
Met Cys Arg Asn Ser Arg
The first step to writing the amino acid sequence is to find the start codon AUG. Then,
the nucleotide sequence is separated into triplets: CU AUG UGU CGU AAC AGC CGA
UGA. We stop the translation at UGA because that triplet encodes a stop codon. When
we convert these codons to amino acids, the sequence becomes Met Cys Arg Asn Ser
Arg. - ANS A scientist sequencing mRNA identifies the following strand:
CUAUGUGUCGUAACAGCCGAUGACCCG
What is the sequence of the amino acid chain this mRNA makes when it is translated?
sigma (σ) - ANS Which subunit of the E. coli polymerase confers specificity to
transcription?
they are similar in all bacterial species - ANS The -10 and -35 regions of prokaryotic
promoters are called consensus sequences because ________.
DNA is different from RNA in that T nucleotides in DNA are replaced with U nucleotides
in RNA. Therefore, they could never be identical in base sequence. - ANS If mRNA is
complementary to the DNA template strand and the DNA template strand is
complementary to the DNA nontemplate strand, then why are base sequences of mRNA
and the DNA nontemplate strand not identical? Could they ever be?
bio 1107 exam 3
, 3
bio 1107 exam 3
ACUAUCUUCGUGAGAUG
By examining the DNA sequence, we can see that there is a -10 consensus sequence
near the 3' end of the fragment. If we then count downstream, the +1 initiation site is
the T immediately following the sequence AAT. This means the DNA fragment that will
serve as the template for transcription has the sequence TGATAGAAGCACTCTAC. The
mRNA made from this template will have complimentary base pairing with uracil (U)
instead of thymine (T). This gives us ACUAUCUUCGUGAGAUG as the transcribed mRNA
sequence. - ANS A fragment of bacterial DNA reads:
3' -TACCTATAATCTCAATTGATAGAAGCACTCTAC- 5'
Assuming that this fragment is the template strand, what is the sequence of mRNA that
would be transcribed? (Hint: Be sure to identify the initiation site.)
TATA box - ANS Which feature of promoters can be found in both prokaryotes and
eukaryotes?
pre-mRNAs - ANS What transcripts will be most affected by low levels of α-amanitin?
bio 1107 exam 3
bio 1107 exam 3
BIOL 1107: Principles of Biology I Exam3- (Latest 2026/ 2027 Update)
Review| 100% Verified Questions & Answers | Grade A.
Scientists use reverse transcriptase enzymes to make DNA from RNA - ANS Which event
contradicts the central dogma of molecular biology?
For 200 commonly occurring amino acids, codons consisting of four types of nucleotides
would have to be at least four nucleotides long, because 44 = 256. There would be much
less degeneracy in this case. - ANS Imagine if there were 200 commonly occurring amino
acids instead of 20. Given what you know about the genetic code, what would be the
shortest possible codon length? Explain.
Codons that specify the same amino acid typically only differ by one nucleotide. In
addition, amino acids with chemically similar side chains are encoded by similar codons.
This nuance of the genetic code ensures that a single-nucleotide substitution mutation
might either specify the same amino acid and have no effect, or may specify a similar
amino acid, preventing the protein from being rendered completely nonfunctional. -
ANS Discuss how degeneracy of the genetic code makes cells more robust to mutations.
bio 1107 exam 3
, 2
bio 1107 exam 3
Met Cys Arg Asn Ser Arg
The first step to writing the amino acid sequence is to find the start codon AUG. Then,
the nucleotide sequence is separated into triplets: CU AUG UGU CGU AAC AGC CGA
UGA. We stop the translation at UGA because that triplet encodes a stop codon. When
we convert these codons to amino acids, the sequence becomes Met Cys Arg Asn Ser
Arg. - ANS A scientist sequencing mRNA identifies the following strand:
CUAUGUGUCGUAACAGCCGAUGACCCG
What is the sequence of the amino acid chain this mRNA makes when it is translated?
sigma (σ) - ANS Which subunit of the E. coli polymerase confers specificity to
transcription?
they are similar in all bacterial species - ANS The -10 and -35 regions of prokaryotic
promoters are called consensus sequences because ________.
DNA is different from RNA in that T nucleotides in DNA are replaced with U nucleotides
in RNA. Therefore, they could never be identical in base sequence. - ANS If mRNA is
complementary to the DNA template strand and the DNA template strand is
complementary to the DNA nontemplate strand, then why are base sequences of mRNA
and the DNA nontemplate strand not identical? Could they ever be?
bio 1107 exam 3
, 3
bio 1107 exam 3
ACUAUCUUCGUGAGAUG
By examining the DNA sequence, we can see that there is a -10 consensus sequence
near the 3' end of the fragment. If we then count downstream, the +1 initiation site is
the T immediately following the sequence AAT. This means the DNA fragment that will
serve as the template for transcription has the sequence TGATAGAAGCACTCTAC. The
mRNA made from this template will have complimentary base pairing with uracil (U)
instead of thymine (T). This gives us ACUAUCUUCGUGAGAUG as the transcribed mRNA
sequence. - ANS A fragment of bacterial DNA reads:
3' -TACCTATAATCTCAATTGATAGAAGCACTCTAC- 5'
Assuming that this fragment is the template strand, what is the sequence of mRNA that
would be transcribed? (Hint: Be sure to identify the initiation site.)
TATA box - ANS Which feature of promoters can be found in both prokaryotes and
eukaryotes?
pre-mRNAs - ANS What transcripts will be most affected by low levels of α-amanitin?
bio 1107 exam 3
