Geschreven door studenten die geslaagd zijn Direct beschikbaar na je betaling Online lezen of als PDF Verkeerd document? Gratis ruilen 4,6 TrustPilot
logo-home
Essay

Experiments form protein to cell containing efflux pump inhibition of cytochrome

Beoordeling
-
Verkocht
-
Pagina's
23
Cijfer
7-8
Geüpload op
21-12-2021
Geschreven in
2021/2022

Experiments form protein to cell containing efflux pump inhibition of cytochrome using verapamil, bedaquiline and chloropromaize

Voorbeeld van de inhoud

CydDC knock-out using CRISPR-Cas9 in Escherichia coli MB43

Abstract
The rise of antibiotic use has resulted in a global antibiotic resistance crisis, which
emphasizes the need for new antibiotic targets. A possible new antibiotic target is the
CydDC complex, because it has been shown to be important for bacterial survival under
antibiotic stress. The CydDC is an ATP-binding cassette transporter important in the
assembly of cytochrome Bd-1’s haem groups, part of the oxidative respiratory chain.
This experiment aims to investigate the exact function of the assembly factor CydDC by
knocking it out. To achieve this, E. coli MB43 bacteria containing pCas9 plasmids were
prepared and transformed with pTarget using electrocompetent cells. PTarget
N20CydC_HR_UpCydC_DwnCydD was isolated from E. coli DH5α and the validation of the
transformants were identified by colony PCR. Afterwards the cultures were diluted in
lysogeny broth and pTarget was cured with IPTG.
pCas and pTarget plasmids were constructed using Benchling software. On the agar plates
there is a successful absence of colonies after inoculation, due to cytochrome Bd and cydDC
assembly removal. The transformed strains were not perfectly run on the PCR, but in the
present cases, they had combined strains of different DNA colonies. The OD value of the
positive colonies after pTarget removal is 0,021, resulting in a cell count of 2,1*107 per 100
μL.
One of the transformed strains of the PCR showed two clear bands, probably due to the fact
that two colonies of the agar plate merged. Some of the controls in the PCR lacked bands,
which could either be because the bacteria lacked when sampling the agar plate, or the
bacteria developed a natural resistance. Shorter PCR conduction time could have affected
our results.
Plasmid curing had gone wrong, since both of the agar plates contained fewer colonies than
the expected 100 cells/100 μL and 1000 cells/100 μL. This could be caused by wrong
dilutions, or a too short incubation time.

Introduction
The discovery of antibiotics in the 20th century has revolutionized medicine in many ways
(Davies & Davies, 2010). Unfortunately, with the rise of antibiotic use, so came the rapid
appearance of resistant bacteria. The discovery of new antibiotics can hardly keep up with
the pace of emerging resistant pathogens, and thus antibiotic resistance has rapidly become
a global crisis (Aslam et al., 2018). This crisis highlights the clinical misuse of antibiotics, and
the lack of new antibiotic targets. In the endeavour to find new antibiotic targets, bacterial
metabolism has shown potential (Giuffrè et al., 2014). One possible target for new antibiotics
is the CydDC complex.

The CydDC complex is an ATP-binding cassette (ABC) transporter that transports cysteine
and glutathione from the cytoplasm to the periplasm in a variety of bacterial species,
including Escherichia coli (Shepherd, 2015). The transport of these molecules aids the redox
homeostasis of the periplasm, which is crucial for a multitude of cellular processes (Poole et
al., 2019). Maintaining the redox poise in the periplasm of E. coli aids correct disulfate
binding, motility, tolerance to oxidative and nitrosative stresses and cytochrome biogenesis
(Shepherd, 2015).

,The expression of CydDC is directly linked to the incorporation of haem factors in
cytoplasmic cytochromes, among them cytochrome bd (Poole et al., 2019). CydDC’s role in
cytochrome bd-I assembly was the first functional role of the complex that was identified
(Shepherd, 2015). It was found that in the absence of CydDC, cytochrome bd is still
synthesized and inserted into the membrane but lacks the haem groups essential for
function (Poole et al., 2019). Thus, CydDC expression is not essential for the expression of
structural genes, but the complex plays an important role in assembly of the haem groups of
cytochrome bd.

Cytochrome bd complex is involved in the oxidative respiratory chain, specifically, the
transfer of electrons onto oxygen. This complex has been shown to be important for
Mycobacterium bacterial survival under antibiotic stress, in for example E. coli (Giuffrè et al.,
2014). Targeting the assembly factor of this complex, might be a way of evading antibiotic
resistance while meanwhile targeting the bacterial metabolism.

The aim of this experiment was to knock-out the assembly factor (CydDC) of cytochrome bd
via the CRISPR-Cas system in E. coli. The CydDC knockout could possibly allow for more
insight into the function of the assembly factor, and the possible applications as antibiotic
targets.

Materials and Methods
Except for some small differences, which are mentioned beneath, the methods used in this
experiment derive from the protocol of Jiang et al. (2015). The plasmids which were used for
this experiment were constructed using the Benchling software (Cloud-Based Informatics
Platform for Life Sciences R&D, 2021).

Induced competent E. coli MB43
E. coli MB43 containing pCas9 plasmid were already prepared according to the protocol of
Jiang et al. (2015).

Preparation electrocompetent cells
The electrocompetent cells needed for the transformation of MB43 + pCas9 with pTarget,
were prepared following the protocol of Jiang et al. (2015).

Isolation of pTarget
For the isolation of pTarget from E. coli DH5 α, overnight grown DH5 α with pTarget
N20CydC_HR_UpCydC_DwnCydD was provided. The provided DH5 α with pTarget was
first suspended in 1 mL PBS before starting the QIAprep® Spin Miniprep Kit (cat. nos. 27104
and 27106) protocol without LyseBlue to isolate pTarget from DH5 α (QIAprep® Miniprep
Handbook, 2020).

Positive control
The positive control sample was already prepared according to the protocol of Jiang et al.
(2015).

Colony PCR and gel electrophoresis
Validation of transformants were identified by colony PCR. Forward cyd primer upstream of
the HR region (FW CYDDeco: CGTTGCCGGTCTGTTTGTTGCTATCGG) and

, ReverseDown primer (RevDown cydC: TTCATACTACGGCTGATATGCAGTGATTCTG)
unique for the HR region were used. Furthermore, the colony PCR was loaded on agarose
electrophoresis gel and run (Jiang et al. 2015). Making the agarose gel, GelRed® dye was
used instead of Ethidium bromide dye.

Plasmid curing
For the curing of pTarget with IPTG, the protocol of Jiang et al. (2015) was used. The
cultures were diluted in lysogeny broth (LB) instead of phosphate buffered saline (PBS).

Results
Plasmids
The plasmids which were used for this experiment were constructed using the Benchling.
software. The pCas plasmid contains multiple domains, as seen in Figure 1.




Figure 1: pCas9 plasmid made in Benchling.

Most notably, a Cas 9 region under the control of an arabinose-inducible promoter (araC), a
temperature sensitive replicon (Spy-Tem) which mediates the plasmids replication, a λ-Red
(containing the gamma, beta and exo genes) region for circular DNA stabilisation and
successful genome editing, a sgRNA containing an N20 sequence for the pMB1 replicon
region within pTarget controlled by an IPTG-inducible promoter (lacI and lacO), and a
kanamycin resistance gene (kanR).

Documentinformatie

Geüpload op
21 december 2021
Aantal pagina's
23
Geschreven in
2021/2022
Type
ESSAY
Docent(en)
Onbekend
Cijfer
7-8

Onderwerpen

€8,99
Krijg toegang tot het volledige document:

Verkeerd document? Gratis ruilen Binnen 14 dagen na aankoop en voor het downloaden kun je een ander document kiezen. Je kunt het bedrag gewoon opnieuw besteden.
Geschreven door studenten die geslaagd zijn
Direct beschikbaar na je betaling
Online lezen of als PDF

Maak kennis met de verkoper

Seller avatar
De reputatie van een verkoper is gebaseerd op het aantal documenten dat iemand tegen betaling verkocht heeft en de beoordelingen die voor die items ontvangen zijn. Er zijn drie niveau’s te onderscheiden: brons, zilver en goud. Hoe beter de reputatie, hoe meer de kwaliteit van zijn of haar werk te vertrouwen is.
lempers Vrije Universiteit Amsterdam
Bekijk profiel
Volgen Je moet ingelogd zijn om studenten of vakken te kunnen volgen
Verkocht
10
Lid sinds
5 jaar
Aantal volgers
7
Documenten
13
Laatst verkocht
1 jaar geleden

5,0

1 beoordelingen

5
1
4
0
3
0
2
0
1
0

Recent door jou bekeken

Waarom studenten kiezen voor Stuvia

Gemaakt door medestudenten, geverifieerd door reviews

Kwaliteit die je kunt vertrouwen: geschreven door studenten die slaagden en beoordeeld door anderen die dit document gebruikten.

Niet tevreden? Kies een ander document

Geen zorgen! Je kunt voor hetzelfde geld direct een ander document kiezen dat beter past bij wat je zoekt.

Betaal zoals je wilt, start meteen met leren

Geen abonnement, geen verplichtingen. Betaal zoals je gewend bent via iDeal of creditcard en download je PDF-document meteen.

Student with book image

“Gekocht, gedownload en geslaagd. Zo makkelijk kan het dus zijn.”

Alisha Student

Bezig met je bronvermelding?

Maak nauwkeurige citaten in APA, MLA en Harvard met onze gratis bronnengenerator.

Bezig met je bronvermelding?

Veelgestelde vragen