Geschreven door studenten die geslaagd zijn Direct beschikbaar na je betaling Online lezen of als PDF Verkeerd document? Gratis ruilen 4,6 TrustPilot
logo-home
College aantekeningen

Broad Overview of Biology

Beoordeling
-
Verkocht
-
Pagina's
7
Geüpload op
14-09-2024
Geschreven in
2024/2025

Covers: DNA and it's structure Biotechnology and it's uses CRISPR and it's uses PCR (Polymerase chain reaction) tests, and how they are applied in the real world And more...

Instelling
Vak

Voorbeeld van de inhoud

General Note
Tuesday, 23 January 2024 12:19 PM




(Pro Vs Eu) Karyotic Cells
Prokaryotes do not have a nucleus, Eukaryotes do.

Examples of Prokaryotes and Eukaryotes are Bacteria (Pro), Animal or Plant cells (Eu), Fungi (Eu), Protists like Amoeba (Eu).

Cell Theory (Cells are the smallest building block of life, Cells can only be made through other cells/mitosis, All living things are made of
cells, which is why viruses aren't living)

The parts of the cells are called organelles (eg. Nuclei, Ribosomes, Mitochondria)

Each organelle has a purpose, eg. Mitochondria makes ATP energy from glucose, which then is used to power other biological proteins

Endoplasmic Reticulum packages proteins

Ribosomes make protein

Nuclei hold the DNA

Plant's Chloroplast - photosynthesis

Golgi Apparatus - Packages proteins in vesicles


DNA

DNA has a double helix structure composed of a sugar-phosphate backbone and complementary base pairs.

Most genes code for the production of protein, for the function of RNA molecules (like transfer RNA), regulating the expression for other
genes (making genes make more protein, or supress their ability).

The full term is Deoxyribonucleic acid. Ensure to use this during an exam BEFORE the abbreviation (DNA)

Holds instructions for the proteins in our body

Every cell (with a few exceptions) has every instruction for that organism.

There are 46 chromosomes in every cell. 20-35 000 genes in each cell

Red blood cells do not have DNA. (Their purpose is to carry oxygen around the body via Haemoglobin, and Co2 back to your lungs)

They just have "stacks of Haemoglobin"

DNA is otherwise located in the nucleus (Eukaryotic, Prokaryotes do not have a nucleus)

DNA is unique to everyone (small mutations make everyone different)

Exemption being identical twins (maternal twins/ Dizygotic twins)

Zygole is the cell formed when sperm fertilises an egg. When about 8 cells are developed they can split, creating two identical things,
which have the same DNA.

The result of this is identical twins who will look the same, unless there are environmental factors.

Nucleus has chromosomes which are long stretches of DNA.

Structure of DNA

Nucleotides consist of Phosphate groups, which has phosphates, attached to a pentose sugar (comprised of a deoxyribose, a 5 C sugar),
and a nitrogenous base (They are the bases). These are then linked via covalent bonds to other Phosphate Groups




Phosphate group


Covalent Bonds
Nitrogenous Base

, Complementary Base Pairing

A T G or C
Apples in the Tree, Cars in the Garage
Adenine, Thymine, Cytosine, Guanine




Hydrogen Bonding

O has a higher electronegativity, than H. Therefore O takes a greater share of electrons. Due to uneven sharing of electrons, O is slightly
negative, and H is slightly positive. This makes H20 a polar molecule. Covalent bonds has an intermolecular bond, much stronger than a
Hydrogen bond, which is between different molecules. There are hydrogen bonds between the base pairs.
Hydrogen bonds are between the bases in the m




Hydrogen bonds are able to separate during transcription, useful for copying (DNA to RNA) and replication (DNA to DNA). Weak, non
covalent. Oxygen is slightly negative, Hydrogen is slightly positive. Dash lines represent hydrogen bonds.




DNA consists of long strands of nucleotides connected by these bonds, called polynucleotides.

It is also important to remember that DNA is double stranded.

Complimentary Base Pairing Pt. 2

ATGCAATTACGGATCATTATCGAATCTTA
TACGTTAATGCCTAGTAATAGCTTAGAAT

TTAGT
AATCA

GCTAG
CGATC

TAGCCGTATACGATGACT
ATCGGCATATGCTACTGA



DNA Recap

Located on chromo

Grouped into genes

Genes have sequences of DNA

Grouped into 3s called triplets (the sequences)

Each 3 bases code for one amino acid.

TAG codes for one amino acid (TGC, AGT etc.)

These proteins have roles/jobs in the body.

Polymerase Chain Reaction

A process used to make copies or amplify fragments of DNA from even minuscule samples

One of the advantages is speed

The most important part of PCR is DNA polymerase (enzyme)

It makes DNA polymers

STEPS:

1. Denature DNA (raise the temp to separate strands, breaking the bonds between the bases (94 degrees))

Geschreven voor

Instelling
Middelbare school
Vak
School jaar
1

Documentinformatie

Geüpload op
14 september 2024
Aantal pagina's
7
Geschreven in
2024/2025
Type
College aantekeningen
Docent(en)
-
Bevat
Alle colleges

Onderwerpen

€7,07
Krijg toegang tot het volledige document:

Verkeerd document? Gratis ruilen Binnen 14 dagen na aankoop en voor het downloaden kun je een ander document kiezen. Je kunt het bedrag gewoon opnieuw besteden.
Geschreven door studenten die geslaagd zijn
Direct beschikbaar na je betaling
Online lezen of als PDF

Maak kennis met de verkoper
Seller avatar
kazookie

Maak kennis met de verkoper

Seller avatar
kazookie
Volgen Je moet ingelogd zijn om studenten of vakken te kunnen volgen
Verkocht
-
Lid sinds
1 jaar
Aantal volgers
0
Documenten
7
Laatst verkocht
-

0,0

0 beoordelingen

5
0
4
0
3
0
2
0
1
0

Recent door jou bekeken

Waarom studenten kiezen voor Stuvia

Gemaakt door medestudenten, geverifieerd door reviews

Kwaliteit die je kunt vertrouwen: geschreven door studenten die slaagden en beoordeeld door anderen die dit document gebruikten.

Niet tevreden? Kies een ander document

Geen zorgen! Je kunt voor hetzelfde geld direct een ander document kiezen dat beter past bij wat je zoekt.

Betaal zoals je wilt, start meteen met leren

Geen abonnement, geen verplichtingen. Betaal zoals je gewend bent via iDeal of creditcard en download je PDF-document meteen.

Student with book image

“Gekocht, gedownload en geslaagd. Zo makkelijk kan het dus zijn.”

Alisha Student

Bezig met je bronvermelding?

Maak nauwkeurige citaten in APA, MLA en Harvard met onze gratis bronnengenerator.

Bezig met je bronvermelding?

Veelgestelde vragen