EXAM 2 (bio 151) Questions And Answers

Tetrahymena is a genus of free-living ciliates that are common in freshwater ponds. They are model organisms used to study a variety of cellular processes, including plasma membrane fluidity. Tetrahymena can maintain homeostasis by altering the fatty acid composition of their cellular membranes. You grow Tetrahymena in normal temperatures and then expose these Tetrahymena to cold temperatures. Which of the following changes in plasma membrane composition are likely to occur? I. An increase in the concentration of unsaturated fatty acids. II. A decrease in the length of the fatty acid tails. III. A decrease in the concentration of unsaturated fatty acid tails. IV. An increase in the length of the fatty acid tails. - ANS I and II Which of the following statements about the sodium-potassium pump are true? I. The sodium-potassium pump moves potassium ions (K+) from an area of high K+ concentration to an area of low K+ concentration. II. The sodium potassium pump is a form of secondary active transport. III. The sodium-potassium pump requires ATP. - ANS III only Sodium-glucose transporters are a family of glucose transporter found in the intestinal mucosa of the small intestine and the proximal tubule of the nephron. These Na-glucose transporters are powered by the Na-K pump. Which of the following correctly describes what happens in the Na-glucose transporter? - ANS Na+ moves down its concentration gradient and glucose moves up You have a sample of cells that have not been exposed to the growth factor. Which of the following would you expect to see when you measure these cells? A. High levels of protein 1 in the cytoplasm. B. TFA is inactive and in the cytoplasm. C. High levels of protein 2 in the cytoplasm. D. SK2 is phosphorylated. E. EB3 is phosphorylated. - ANS B. TFA is inactive and in the cytoplasm. What immediately happens when a signaling molecule binds to a G-protein-coupled-receptor? A. The receptor dimerizes and phosphorylates itself. B. The G-protein binds GTP. C. The G-protein phosphorylates GDP to GTP. D. The receptor phosphorylates the G-protein. E. More than one of the above happens. - ANS B. The G-protein binds GTP. The HSC gene is only expressed in hematopoietic cells, which are adult stem cells that give rise to other blood cells. You want to obtain samples of the HSC DNA and mRNA for your experiments. You have access to white blood cells (differentiated blood cells), embryonic stem cells, and hematopoietic cells. From which cells could you obtain both HSC DNA and mRNA? a. Hematopoietic cells only b. White blood cells only c. Embryonic stem cells only d. Hematopoietic and white blood cells. e. Hematopoietic and embryonic stem cells. - ANS a. Hematopoietic cells only Which of the following statements are true regarding RNA and DNA: I. All RNA is translated to generate proteins. II. RNA nucleotides are linked by phosphodiester bonds. III. Nucleotides of both RNA and DNA contain a 5-carbon sugar. A. I only B. II only C. II and III D. I and III E. I, II, and III - ANS C. II and III An mRNA has the following sequence: 3' - AUGGAGUGCCACGUGGGCAGUAUGUGA - 5' How many amino acids long would the protein be that is translated from this mRNA? a. 4 b. 5 c. 6 d. 8 e. 9 - ANS b. 5 One of the codons for the amino acid isoleucine is 5'AUC 3'. What is the sequence of the anticodon in the tRNA that carries isoleucine to the ribosome? A. 3' AUC 5' B. 3' TAG 5' C. 3' UAG 5' D. 5' UAG 3' E. 5' TAG 3' - ANS C. 3' UAG 5' 1. Which of the following statements about this molecule are true? I. This molecule is cholesterol. II. Region A is polar and region B region is nonpolar. III. Region C is a saturated fatty acid. (region a is the head (circle), region b is the bent part of the end, region c is the straight end) A. I only B. II only C. I and II D. II and III E. I-III - ANS D. II and III (use growth factor diagram) Which of the following statements about this pathway is/are true? I. SK2 is a phosphatase. II. Expression of protein 2 after the signal is received is an example of a positive feedback loop. III. After the growth factor binds to the receptor, protein 1 will be expressed. A. II only B. III only C. II and III D. I-III E. None of the statements are true - ANS B. III only Use the receptor kinase diagram to answer this question. Which best explains these results? Analysis of a cell with a simple kinase pathway shows the following: - The receptors and TK1 molecules are present, but not phosphorylated. - Some TK2 molecules are phosphorylated and others are not. - TFa molecules are all phosphorylated. A. Receptor-mediated endocytosis after the signal has been sent. B. An inhibitor blocks the kinase activity of the receptor. C. TFa expresses a phosphatase that targets TK1 and the receptor. D. The signal was never present to activate this pathway E. A loss-of-function mutation in TK1. - ANS C. TFa expresses a phosphatase that targets TK1 and the receptor. (use cell division diagram)