Geschreven door studenten die geslaagd zijn Direct beschikbaar na je betaling Online lezen of als PDF Verkeerd document? Gratis ruilen 4,6 TrustPilot
logo-home
Tentamen (uitwerkingen)

BIOL 1107 Exam 3 Study – Principles of Biology (NEW 2026–2027) | Complete Verified Questions & Answers for Grade A Success

Beoordeling
-
Verkocht
-
Pagina's
26
Cijfer
A+
Geüpload op
12-12-2025
Geschreven in
2025/2026

This Exam 3 study for BIOL 1107 (Principles of Biology I) provides a complete set of verified questions and answers aligned with the 2026–2027 course updates. It covers all major exam topics, including cell biology, genetics, metabolism, DNA structure, gene expression, and biological systems. Designed for efficient studying, this resource helps students prepare confidently for quizzes, midterms, and final assessments. Ideal for learners seeking accurate, clear, and exam-focused biology review material.

Meer zien Lees minder
Instelling
BIOL 1107
Vak
BIOL 1107

Voorbeeld van de inhoud

1
bio 1107 exam 3




BIOL 1107: Principles of Biology I Exam3- (Latest 2026/ 2027 Update)

Review| 100% Verified Questions & Answers | Grade A.




Scientists use reverse transcriptase enzymes to make DNA from RNA - ANS Which event

contradicts the central dogma of molecular biology?

For 200 commonly occurring amino acids, codons consisting of four types of nucleotides

would have to be at least four nucleotides long, because 44 = 256. There would be much

less degeneracy in this case. - ANS Imagine if there were 200 commonly occurring amino

acids instead of 20. Given what you know about the genetic code, what would be the

shortest possible codon length? Explain.

Codons that specify the same amino acid typically only differ by one nucleotide. In

addition, amino acids with chemically similar side chains are encoded by similar codons.

This nuance of the genetic code ensures that a single-nucleotide substitution mutation

might either specify the same amino acid and have no effect, or may specify a similar

amino acid, preventing the protein from being rendered completely nonfunctional. -

ANS Discuss how degeneracy of the genetic code makes cells more robust to mutations.


bio 1107 exam 3

, 2
bio 1107 exam 3

Met Cys Arg Asn Ser Arg



The first step to writing the amino acid sequence is to find the start codon AUG. Then,

the nucleotide sequence is separated into triplets: CU AUG UGU CGU AAC AGC CGA

UGA. We stop the translation at UGA because that triplet encodes a stop codon. When

we convert these codons to amino acids, the sequence becomes Met Cys Arg Asn Ser

Arg. - ANS A scientist sequencing mRNA identifies the following strand:

CUAUGUGUCGUAACAGCCGAUGACCCG



What is the sequence of the amino acid chain this mRNA makes when it is translated?

sigma (σ) - ANS Which subunit of the E. coli polymerase confers specificity to

transcription?

they are similar in all bacterial species - ANS The -10 and -35 regions of prokaryotic

promoters are called consensus sequences because ________.

DNA is different from RNA in that T nucleotides in DNA are replaced with U nucleotides

in RNA. Therefore, they could never be identical in base sequence. - ANS If mRNA is

complementary to the DNA template strand and the DNA template strand is

complementary to the DNA nontemplate strand, then why are base sequences of mRNA

and the DNA nontemplate strand not identical? Could they ever be?

bio 1107 exam 3

, 3
bio 1107 exam 3

ACUAUCUUCGUGAGAUG



By examining the DNA sequence, we can see that there is a -10 consensus sequence

near the 3' end of the fragment. If we then count downstream, the +1 initiation site is

the T immediately following the sequence AAT. This means the DNA fragment that will

serve as the template for transcription has the sequence TGATAGAAGCACTCTAC. The

mRNA made from this template will have complimentary base pairing with uracil (U)

instead of thymine (T). This gives us ACUAUCUUCGUGAGAUG as the transcribed mRNA

sequence. - ANS A fragment of bacterial DNA reads:



3' -TACCTATAATCTCAATTGATAGAAGCACTCTAC- 5'



Assuming that this fragment is the template strand, what is the sequence of mRNA that

would be transcribed? (Hint: Be sure to identify the initiation site.)

TATA box - ANS Which feature of promoters can be found in both prokaryotes and

eukaryotes?

pre-mRNAs - ANS What transcripts will be most affected by low levels of α-amanitin?




bio 1107 exam 3

Geschreven voor

Instelling
BIOL 1107
Vak
BIOL 1107

Documentinformatie

Geüpload op
12 december 2025
Aantal pagina's
26
Geschreven in
2025/2026
Type
Tentamen (uitwerkingen)
Bevat
Vragen en antwoorden

Onderwerpen

€11,48
Krijg toegang tot het volledige document:

Verkeerd document? Gratis ruilen Binnen 14 dagen na aankoop en voor het downloaden kun je een ander document kiezen. Je kunt het bedrag gewoon opnieuw besteden.
Geschreven door studenten die geslaagd zijn
Direct beschikbaar na je betaling
Online lezen of als PDF


Ook beschikbaar in voordeelbundel

Maak kennis met de verkoper

Seller avatar
De reputatie van een verkoper is gebaseerd op het aantal documenten dat iemand tegen betaling verkocht heeft en de beoordelingen die voor die items ontvangen zijn. Er zijn drie niveau’s te onderscheiden: brons, zilver en goud. Hoe beter de reputatie, hoe meer de kwaliteit van zijn of haar werk te vertrouwen is.
DoctorKen Chamberlain College Of Nursing
Volgen Je moet ingelogd zijn om studenten of vakken te kunnen volgen
Verkocht
720
Lid sinds
2 jaar
Aantal volgers
113
Documenten
5908
Laatst verkocht
21 uur geleden
All Solutions

PASS The First Time! School is demanding, and the right study materials make the difference. I provide well-organized, exam-focused resources designed to help students understand key concepts, study efficiently, and perform confidently on assessments. Each resource is carefully structured to align with course objectives and real exam expectations, making complex material clearer and easier to retain. Whether you’re preparing for quizzes, midterms, finals, or comprehensive exams, these materials are created for students who value clarity, accuracy, and results. Academics can be challenging — I’m here to help simplify the process. #Study guides #Exam preparation #Test materials #Study documents #Exam resources #Test study aids #Study notes #Exam study guides #Study materials #Exam papers

Lees meer Lees minder
3,8

130 beoordelingen

5
62
4
22
3
25
2
5
1
16

Recent door jou bekeken

Waarom studenten kiezen voor Stuvia

Gemaakt door medestudenten, geverifieerd door reviews

Kwaliteit die je kunt vertrouwen: geschreven door studenten die slaagden en beoordeeld door anderen die dit document gebruikten.

Niet tevreden? Kies een ander document

Geen zorgen! Je kunt voor hetzelfde geld direct een ander document kiezen dat beter past bij wat je zoekt.

Betaal zoals je wilt, start meteen met leren

Geen abonnement, geen verplichtingen. Betaal zoals je gewend bent via iDeal of creditcard en download je PDF-document meteen.

Student with book image

“Gekocht, gedownload en geslaagd. Zo makkelijk kan het dus zijn.”

Alisha Student

Bezig met je bronvermelding?

Maak nauwkeurige citaten in APA, MLA en Harvard met onze gratis bronnengenerator.

Bezig met je bronvermelding?

Veelgestelde vragen