Werkcollege week 1
1. Below is the beginning of the double-stranded DNA sequence of a gene (introns in
lowercase, exons in uppercase, the start codon is underlined).
5’.... caggcgcCGGAGGACTAGCCTGGGGTCACAGGGATGCCGCGGCTCCTCCGCTTGTCCCTGCTGT...
3’.... gtccgcgGCCTCCTGATCGGACCCCAGTGTCCCTACGGCGCCGAGGAGGCGAACAGGGACGACA...
a. What is the difference between the template strand and coding strand of DNA?
Which side will be copied by RNA polymerase II?
Only one of the two DNA strands serve as a template for transcription. The antisense
strand of DNA is read by RNA polymerase from the 3' end to the 5' end during
transcription (3' → 5'). The complementary RNA is created in the opposite direction,
in the 5' → 3' direction, matching the sequence of the sense strand with the
exception of switching uracil for thymine. This directionality is because RNA
polymerase can only add nucleotides to the 3' end of the growing mRNA chain.
b. How will the mRNA sequence and the protein sequence look (use the codon table
below).
mRNA seq (no intron, but UTR, U instead of T):
CGGAGGACUAGCCUGGGGUCACAGGGAUGCCGCGGCUCCUCCGCUUGUCCCUGCUG
Protein sequence (from start codon): M P R L L R L S L L
2. A DNA sequence consists of a repetition of four letters (bases)
a. Give the structure of these 4 bases and show how base pairing occurs.
, Adenine (A), Guanine (G), Cytosine (C) and Thymine (T). These represent the
nitrogenous bases of the nucleotides that make up the DNA. DNA consists of a
sequence of nucleotides linked by phosphodiester bonds. Each nucleotide consists of
1. A nitrogenous base, 2. A deoxyribose and 3. A phosphate group.
b. Which base pair binds more strongly?
G-C bind stronger: 3 hydrogen bonds instead of 2
3. What is the difference in structure between DNA and RNA?
RNA has Uracil (U) instead of Thimidine (T)
RNA has a ribose instead of deoxiribose in the backbone
Genomic DNA is double-stranded and mRNA is single-stranded
4. The following processes take place in a eukaryotic cell.
, a. Indicate for each of the process in which subcellular compartment it takes place
b. How is this different from a prokaryotic cell?
Process Location
RNA synthese Nucleus
Protein synthesis Cytosol
Protein glycosylation ER and Golgi
RNA splicing Nucleus
A prokaryotic cell has no nucleus and the RNA and protein synthesis both take place
(simultaneously) in the cytoplasm of the cell, there is no splicing. Glycosylation is limited
and occurs mainly on the outside of the plasma membrane (in the periplasm).
5. What is the function of a promoter? Where is it normally found in the sequence,
upstream or downstream of the gene?
The promoter sequence is a DNA sequence, which determines where transcription of a
gene by RNA polymerase begins. The promoter is directly upstream (just in front) of the
readable gene. RNA polymerase and the necessary transcription factors can bind to the
promoter sequence and start transcription.
6. Indicate the function of the following RNAs in the cell:
1. mRNA= messenger RNA: for the expression of a protein (coding)
2. rRNA= ribosomal RNA: important for the structure/function of the ribosome
(ribosome consists of 60% rRNA and 40% protein protein)
3. miRNA = microRNA: small pieces of RNA involved in the regulation of genes
4. tRNA= transfer RNA: adaptor molecule composed of RNA, typically 76 to 90
nucleotides in length, that serves as the physical link between the mRNA
and the amino acid sequence of proteins.
7. N-linked glycosylation is important for the function of proteins
a. In which compartment does N-linked glycosylation of proteins take place?
ER and Golgi
b. What is the effect of this posttranslational modification on the stability and solubility
of a protein?
Functions of N-linked glycans
1. Provides structural components to the cell wall and extracellular matrix.
Intrinsic 2. Modify protein properties such as stability and solubility. (More stable to high
temperature, pH, etc.)
1. Directs trafficking of glycoproteins.
Extrinsic
2. Mediates cell signalling. (Cell-Cell and Cell-Matrix interactions)
c. Why is it important to know that N-linked glycosylation varies from organism to
organism?
, Therapeutic proteins made in another species may have abnormal glyscosilation,
which can affect the function and recognition by the immune system (immune
response against the protein).
N-linked glycans have intrinsic and extrinsic functions
Within the immune system the N-linked glycans on an immune cell's surface will help dictate that
migration pattern of the cell, e.g. immune cells that migrate to the skin have specific glycosylations
that favor homing to that site. The glycosylation patterns on the various immunoglobulins including
IgE, IgM, IgD, IgE, IgA, and IgG bestow them with unique effector functions by altering their affinities
for Fc and other immune receptors. Glycans may also be involved in "self" and "non self"
discrimination, which may be relevant to the pathophysiology of various autoimmune diseases.
8. Indicate where the following items might be located in the vectors and explain their
role: ORI, promoter, enhancer, signal peptide, restriction enzyme identifiers, protein tag,
5'UTR, start codon, poly-A signal sequence, resistance marker.
ORI: origin of replication. The origin of replication (also called the replication
origin) is a particular sequence in a genome at which replication is initiated. This can
either involve the replication of DNA in living organisms such as prokaryotes and
eukaryotes, or that of DNA or RNA in viruses, such as double-stranded RNA viruses.
DNA replication may proceed from this point bidirectionally or unidirectionally. The
specific structure of the origin of replication varies somewhat from species to species,
but all share some common characteristics such as high AT content (repeats of
adenine and thymine are easier to separate because their base stacking interactions are
not as strong as those of guanine and cytosine). The origin of replication binds the
pre-replication complex, a protein complex that recognizes, unwinds, and begins to
copy DNA. source: Wikipedia.
Bacterial Plasmid Origins: Many bacteria, including E. coli, contain plasmids that
each contain an origin of replication. These are separate from the origins of
replication that are used by the bacteria to copy their genome and often function very
differently. For example, the E. coli plasmid pBR322 uses a protein called Rop/Rom
to regulate the number of plasmids that are within each bacterial cell. The most
common origin of replication that is used in plasmids for genetic engineering is called
pUC. This origin is derived from pBR322 but it contains two mutations. One single
point mutation in the origin itself and another that deletes the Rop/Rom gene. This
removes all the regulatory constraints on the plasmids replication and the bacteria
then go from producing 30-40 plasmids per cell with pBR322 up to producing over
500 with pUC. This allows genetic engineers to produce large quantities of DNA for
research purposes. Other origins of replication include pSC101 (derived from
Salmonella, around 5 copies per cell), 15A origin (derived from p15A, 10-20 copies
per cell) and Bacterial artificial chromosomes (1 copy per cell). source: Wikipedia.
Promoter: a regulatory region of DNA usually located upstream of a gene, providing
a control point for regulated gene transcription. Transcription factors can bind here
and initiate transcription by RNA-polymerase II.
Enhancer: a short region of DNA that can increase transcription of genes.
An enhancer is a short (50-1500 bp) region of DNA that can be bound
1. Below is the beginning of the double-stranded DNA sequence of a gene (introns in
lowercase, exons in uppercase, the start codon is underlined).
5’.... caggcgcCGGAGGACTAGCCTGGGGTCACAGGGATGCCGCGGCTCCTCCGCTTGTCCCTGCTGT...
3’.... gtccgcgGCCTCCTGATCGGACCCCAGTGTCCCTACGGCGCCGAGGAGGCGAACAGGGACGACA...
a. What is the difference between the template strand and coding strand of DNA?
Which side will be copied by RNA polymerase II?
Only one of the two DNA strands serve as a template for transcription. The antisense
strand of DNA is read by RNA polymerase from the 3' end to the 5' end during
transcription (3' → 5'). The complementary RNA is created in the opposite direction,
in the 5' → 3' direction, matching the sequence of the sense strand with the
exception of switching uracil for thymine. This directionality is because RNA
polymerase can only add nucleotides to the 3' end of the growing mRNA chain.
b. How will the mRNA sequence and the protein sequence look (use the codon table
below).
mRNA seq (no intron, but UTR, U instead of T):
CGGAGGACUAGCCUGGGGUCACAGGGAUGCCGCGGCUCCUCCGCUUGUCCCUGCUG
Protein sequence (from start codon): M P R L L R L S L L
2. A DNA sequence consists of a repetition of four letters (bases)
a. Give the structure of these 4 bases and show how base pairing occurs.
, Adenine (A), Guanine (G), Cytosine (C) and Thymine (T). These represent the
nitrogenous bases of the nucleotides that make up the DNA. DNA consists of a
sequence of nucleotides linked by phosphodiester bonds. Each nucleotide consists of
1. A nitrogenous base, 2. A deoxyribose and 3. A phosphate group.
b. Which base pair binds more strongly?
G-C bind stronger: 3 hydrogen bonds instead of 2
3. What is the difference in structure between DNA and RNA?
RNA has Uracil (U) instead of Thimidine (T)
RNA has a ribose instead of deoxiribose in the backbone
Genomic DNA is double-stranded and mRNA is single-stranded
4. The following processes take place in a eukaryotic cell.
, a. Indicate for each of the process in which subcellular compartment it takes place
b. How is this different from a prokaryotic cell?
Process Location
RNA synthese Nucleus
Protein synthesis Cytosol
Protein glycosylation ER and Golgi
RNA splicing Nucleus
A prokaryotic cell has no nucleus and the RNA and protein synthesis both take place
(simultaneously) in the cytoplasm of the cell, there is no splicing. Glycosylation is limited
and occurs mainly on the outside of the plasma membrane (in the periplasm).
5. What is the function of a promoter? Where is it normally found in the sequence,
upstream or downstream of the gene?
The promoter sequence is a DNA sequence, which determines where transcription of a
gene by RNA polymerase begins. The promoter is directly upstream (just in front) of the
readable gene. RNA polymerase and the necessary transcription factors can bind to the
promoter sequence and start transcription.
6. Indicate the function of the following RNAs in the cell:
1. mRNA= messenger RNA: for the expression of a protein (coding)
2. rRNA= ribosomal RNA: important for the structure/function of the ribosome
(ribosome consists of 60% rRNA and 40% protein protein)
3. miRNA = microRNA: small pieces of RNA involved in the regulation of genes
4. tRNA= transfer RNA: adaptor molecule composed of RNA, typically 76 to 90
nucleotides in length, that serves as the physical link between the mRNA
and the amino acid sequence of proteins.
7. N-linked glycosylation is important for the function of proteins
a. In which compartment does N-linked glycosylation of proteins take place?
ER and Golgi
b. What is the effect of this posttranslational modification on the stability and solubility
of a protein?
Functions of N-linked glycans
1. Provides structural components to the cell wall and extracellular matrix.
Intrinsic 2. Modify protein properties such as stability and solubility. (More stable to high
temperature, pH, etc.)
1. Directs trafficking of glycoproteins.
Extrinsic
2. Mediates cell signalling. (Cell-Cell and Cell-Matrix interactions)
c. Why is it important to know that N-linked glycosylation varies from organism to
organism?
, Therapeutic proteins made in another species may have abnormal glyscosilation,
which can affect the function and recognition by the immune system (immune
response against the protein).
N-linked glycans have intrinsic and extrinsic functions
Within the immune system the N-linked glycans on an immune cell's surface will help dictate that
migration pattern of the cell, e.g. immune cells that migrate to the skin have specific glycosylations
that favor homing to that site. The glycosylation patterns on the various immunoglobulins including
IgE, IgM, IgD, IgE, IgA, and IgG bestow them with unique effector functions by altering their affinities
for Fc and other immune receptors. Glycans may also be involved in "self" and "non self"
discrimination, which may be relevant to the pathophysiology of various autoimmune diseases.
8. Indicate where the following items might be located in the vectors and explain their
role: ORI, promoter, enhancer, signal peptide, restriction enzyme identifiers, protein tag,
5'UTR, start codon, poly-A signal sequence, resistance marker.
ORI: origin of replication. The origin of replication (also called the replication
origin) is a particular sequence in a genome at which replication is initiated. This can
either involve the replication of DNA in living organisms such as prokaryotes and
eukaryotes, or that of DNA or RNA in viruses, such as double-stranded RNA viruses.
DNA replication may proceed from this point bidirectionally or unidirectionally. The
specific structure of the origin of replication varies somewhat from species to species,
but all share some common characteristics such as high AT content (repeats of
adenine and thymine are easier to separate because their base stacking interactions are
not as strong as those of guanine and cytosine). The origin of replication binds the
pre-replication complex, a protein complex that recognizes, unwinds, and begins to
copy DNA. source: Wikipedia.
Bacterial Plasmid Origins: Many bacteria, including E. coli, contain plasmids that
each contain an origin of replication. These are separate from the origins of
replication that are used by the bacteria to copy their genome and often function very
differently. For example, the E. coli plasmid pBR322 uses a protein called Rop/Rom
to regulate the number of plasmids that are within each bacterial cell. The most
common origin of replication that is used in plasmids for genetic engineering is called
pUC. This origin is derived from pBR322 but it contains two mutations. One single
point mutation in the origin itself and another that deletes the Rop/Rom gene. This
removes all the regulatory constraints on the plasmids replication and the bacteria
then go from producing 30-40 plasmids per cell with pBR322 up to producing over
500 with pUC. This allows genetic engineers to produce large quantities of DNA for
research purposes. Other origins of replication include pSC101 (derived from
Salmonella, around 5 copies per cell), 15A origin (derived from p15A, 10-20 copies
per cell) and Bacterial artificial chromosomes (1 copy per cell). source: Wikipedia.
Promoter: a regulatory region of DNA usually located upstream of a gene, providing
a control point for regulated gene transcription. Transcription factors can bind here
and initiate transcription by RNA-polymerase II.
Enhancer: a short region of DNA that can increase transcription of genes.
An enhancer is a short (50-1500 bp) region of DNA that can be bound
