MICRO 3050

MICRO 3050 Exam 4 QUESTIONS AND ANSWERS WITH COMPLETE SOLUTIONS VERIFIED GRADED A++ Leave the first rating Terms in this set (237) The intestinal microbiota (microflora) plays a role in: a. Training the immune system b. Production of essential vitamins for the host c. Colonization resistance d. All of the above d. all of the above Which one of the following statements does NOT describe transducing particles? a. They play a role in the transfer of bacterial genes b. ...

MICRO3050 midterm EXAM QUESTIONS AND VERIFIED ANSWERS LATEST RELEASE Leave the first rating Terms in this set (77) Which of the following DNA molecules would most likely have the highest denaturing temperature (melting temperature, Tm)? Only a single strand of the double-stranded DNA is shown.Choose one: A. ACGGTGACGGCGCGAGCGC B. ACATTCGTAGTATCGCTTTTT C. AGTTACAGTAACTAACAAAT D. AACACTTAGTTATAATTGATT A Which of the following is not a mechanism by wh...

MICRO 3050 Exam 2 QUESTIONS AND ANSWERS WITH COMPLETE SOLUTIONS GRADED A++ 5.0 (1 review) Practice questions for this set Terms in this set (107) (Bacterial)Endospores A complex, dormant, survival structure that is formed by some bacteria (usually gram positive bacteria that live underground) (location within the cell is species specific). Useful because these structures are RESISTANT to: heat, radiation, chemicals, and desicc...

MICRO 3050- VIROLOGY EXAM QUESTIONS AND ANSWERS WITH COMPLETE SOLUTIONS VERIFIED Leave the first rating Terms in this set (34) What is a virus? What are the two basic components of the extracellular form of a virion? Genetic elements that replicate independently of a cell's chromosome, but requires a living host to replicate -nucleic acid surrounded by protein coat Nucleocapsid Nucleic acid with a protein coat (aka capsid) What makes up an envelope? Lipid bilayer and enve...

MICRO 3050- EXAM 4 QUESTIONS AND ANSWERS WITH COMPLETE SOLUTIONS VERIFIED Leave the first rating Practice questions for this set Terms in this set (142) typhoid fever Salmonella typhi, was a major public health threat before drinking water treatment cholera Vibrio cholera, seven major pandemics since 1817, often occurs in areas with inadequate or no sewage treatment protozoan infections Giardia, Crytosporidium, Entamoeba- may be...

MICRO 3050 Exam 3 QUESTIONS AND ANSWERS WITH COMPLETE SOLUTIONS VERIFIED GRADED A++ Leave the first rating Practice questions for this set Terms in this set (107) medical problems with biofilms: -form on medical devices -cause disease -dental caries (plaques, ferments and degrades teeth) -pneumonia industrial problems with biofilms: - interfere with fluids distribution - potential corrosion quorum sensing: ...

Micro 3050 Midterm EXAM QUESTIONS AND ANSWERS WITH COMPLETE SOLUTIONS VERIFIED Leave the first rating Terms in this set (61) Function of the Ocula eyepiece, magnification 10 x Function of the Objectives the three lenses that help to increase magnification - 10 x, 40 x, and 100 x Function of the Course adjusting knobs bringing objects into focus Function of the Fine adjusting knobs bringing objects into focus at higher objectives Function of the Stage adjustment knobs move...

MICRO 3050 EXAM 2 QUESTIONS AND ANSWERS WITH COMPLETE SOLUTIONS VERIFIED 5.0 (1 review) Terms in this set (359) Which of the following methods used to assess cell numbers of bacteria in a sample would be most likely to underestimate the actual number of bacteria present? a) electronic counter b) turbidity using a spectrophotometer c) direct cell count using a Petroff-Hauser counting chamber and a microscope (not including a dye kit) d) viable cell count using plating method...

MICRO 3050 EXAM 4 QUESTIONS AND ANSWERS WITH COMPLETE SOLUTIONS VERIFIED 5.0 (1 review) Terms in this set (81) Describe lactic acid bacteria and their role in fermented foods. - Gram positives, acid TOLERANT, non-spore forming, commonly found in milk - Typically ferment milk to make dairy products - Heterolactic vs Homolactic Define probiotics and prebiotics - Probiotic: LIVE microorganisms given in adequate amounts to benefit the health of the host - Prebioti...

MICRO 3050 FINAL EXAM QUESTIONS AND ANSWERS WITH COMPLETE SOLUTIONS VERIFIED Leave the first rating Terms in this set (372) temperate phages phages that use both the lytic and lysogenic cycles virulent phages kills host after infection (lytic) -begins multiplying immediately beyond entry to host cell Bacteriophage A virus that infects bacteria - very diverse and structurally complex -contain dsDNA genomes and are naked eclipse phase -while the virus is entering, unco...